RchiOBHm_Chr1g0357141

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
49555926 .. 49556563
638 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58244

Sequence Viewer

Length: 183 bp
ATGCTGTTTGTTGACTGCAATGCTTTTATACTTGCAGATTTCCCACCTACTATCGTTCTGAACCATCCAACTAGTAGGAAGAATAGGACGGGGCTGATTGTGGGGATTGTTGTTGGTGGTGGAGTACTTTTGATTCTATTGTTGTTGGTTTTCTGTATTTTTCAAAGAAGAAAAAAGGATTAA

Protein Analysis

60

Amino Acids

6.67

Weight (kDa)

9.84

Isoelectric Point (pI)

23.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 126
AgsI TTSAA 1 cut(s) 164
AhlI ACTAGT 1 cut(s) 71
BccI CCATC 1 cut(s) 72
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 1 cut(s) 72
BmcAI AGTACT 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 25
BseGI GGATG 1 cut(s) 64
BseMI GCAATG 1 cut(s) 25
BsrDI GCAATG 1 cut(s) 25
BstF5I GGATG 1 cut(s) 64
BtsCI GGATG 1 cut(s) 64
Csp6I GTAC 1 cut(s) 125
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
CviQI GTAC 1 cut(s) 125
FaiI YATR 1 cut(s) 29
FokI GGATG 1 cut(s) 51
FspBI CTAG 1 cut(s) 72
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HinfI GANTC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 60
Hpy8I GTNNAC 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 18, 35
MaeI CTAG 1 cut(s) 72
MboII GAAGA 2 cut(s) 91, 180
MmeI TCCRAC 1 cut(s) 92
MseI TTAA 1 cut(s) 181
PfeI GAWTC 1 cut(s) 133
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SaqAI TTAA 1 cut(s) 181
ScaI AGTACT 1 cut(s) 126
SetI ASST 1 cut(s) 49
SgeI CNNG 3 cut(s) 44, 84, 102
SpeI ACTAGT 1 cut(s) 71
SspMI CTAG 1 cut(s) 72
TatI WGTACW 1 cut(s) 124
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
XspI CTAG 1 cut(s) 72
ZrmI AGTACT 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.