RLG00000002011

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
24315894 .. 24316500
607 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002011

Sequence Viewer

Length: 411 bp
ATGACGACCGCCGCCGGAGCTGCTATGATTCTACCAACAACAGAGGGAGTTTCCCAGACCAAAAATTCTGAAGCATGCCAGACCGGAGCAATGTGCAGCTATAAACTTAGTCCGCTTCGACCCGTAATGCTCGACCCGAATTTGACCTTGGTGGAACCCCAGACAGGCCAGCGATGCTGGCCTGGACTTATGCAAGACCTCACACAGTCCTTTAGGGTTTTCCATGGTCACAATCGTATCAAACGGCTTCTAATCATTGAAATTGAAGACGACGATCTTGTGAAGAAGAACAACTACGATTCGGTTGCGGCGGAGCCTAACAGACTTGACCTCGGACCCGAACGAGCACTCACTAACGCAGCGGGACTGGCGATCTTCATAGATCATGACCTTGTTGGGTGGGCAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

14.95

Weight (kDa)

5.13

Isoelectric Point (pI)

47.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 9, 12, 113, 308, 311, 362
AcsI RAATTY 2 cut(s) 64, 139
AcuI CTGAAG 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 260, 266
AjnI CCWGG 1 cut(s) 181
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
AluBI AGCT 2 cut(s) 20, 99
AluI AGCT 2 cut(s) 20, 99
Alw21I GWGCWC 1 cut(s) 349
AoxI GGCC 2 cut(s) 166, 179
ApeKI GCWGC 3 cut(s) 20, 96, 359
ApoI RAATTY 2 cut(s) 64, 139
AspS9I GGNCC 1 cut(s) 335
AvaII GGWCC 1 cut(s) 335
BaeI ACNNNNGTAYC 2 cut(s) 220, 253
BarI GAAGNNNNNNTAC 2 cut(s) 278, 310
BbsI GAAGAC 1 cut(s) 273
Bbv12I GWGCWC 1 cut(s) 349
BbvI GCAGC 3 cut(s) 7, 108, 371
BceAI ACGGC 1 cut(s) 260
BcgI CGANNNNNNTGC 2 cut(s) 287, 321
BciT130I CCWGG 1 cut(s) 183
BisI GCNGC 5 cut(s) 12, 21, 97, 309, 360
BlsI GCNGC 5 cut(s) 13, 22, 98, 310, 361
Bme1390I CCNGG 1 cut(s) 183
Bme18I GGWCC 1 cut(s) 335
BmgT120I GGNCC 1 cut(s) 335
BmiI GGNNCC 3 cut(s) 156, 315, 337
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 273
BsaJI CCNNGG 3 cut(s) 147, 223, 331
BsaWI WCCGGW 1 cut(s) 83
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 372
Bse3DI GCAATG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 3 cut(s) 147, 223, 331
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMI GCAATG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 372
BseXI GCAGC 3 cut(s) 7, 108, 371
BsgI GTGCAG 1 cut(s) 115
Bsh1285I CGRYCG 1 cut(s) 9
BshFI GGCC 2 cut(s) 168, 181
BsiEI CGRYCG 1 cut(s) 9
BsiHKAI GWGCWC 1 cut(s) 349
BsiSI CCGG 2 cut(s) 15, 84
BslFI GGGAC 1 cut(s) 378
BslI CCNNNNNNNGG 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 378
BsnI GGCC 2 cut(s) 168, 181
Bsp1286I GDGCHC 1 cut(s) 349
Bsp143I GATC 3 cut(s) 274, 372, 382
Bsp19I CCATGG 1 cut(s) 223
BspACI CCGC 6 cut(s) 9, 12, 113, 308, 311, 362
BspANI GGCC 2 cut(s) 168, 181
BspHI TCATGA 1 cut(s) 385
BspLI GGNNCC 3 cut(s) 156, 315, 337
BsrDI GCAATG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 372
BssECI CCNNGG 3 cut(s) 147, 223, 331
BssMI GATC 3 cut(s) 274, 372, 382
BssT1I CCWWGG 2 cut(s) 147, 223
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 207
BstC8I GCNNGC 3 cut(s) 76, 170, 179
BstDEI CTNAG 1 cut(s) 107
BstDSI CCRYGG 1 cut(s) 223
BstKTI GATC 3 cut(s) 277, 375, 385
BstMBI GATC 3 cut(s) 274, 372, 382
BstMCI CGRYCG 1 cut(s) 9
BstMWI GCNNNNNNNGC 5 cut(s) 17, 20, 174, 178, 368
BstNI CCWGG 1 cut(s) 183
BstNSI RCATGY 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 181
BstV1I GCAGC 3 cut(s) 7, 108, 371
BstV2I GAAGAC 1 cut(s) 273
BsuRI GGCC 2 cut(s) 168, 181
BtgI CCRYGG 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 187
Cac8I GCNNGC 3 cut(s) 76, 170, 179
CciI TCATGA 1 cut(s) 385
Cfr13I GGNCC 1 cut(s) 335
CviAII CATG 3 cut(s) 75, 224, 386
CviJI RGCY 6 cut(s) 20, 99, 168, 181, 247, 316
CviKI_1 RGCY 6 cut(s) 20, 99, 168, 181, 247, 316
DdeI CTNAG 1 cut(s) 107
DpnI GATC 3 cut(s) 276, 374, 384
DpnII GATC 3 cut(s) 274, 372, 382
EciI GGCGGA 1 cut(s) 326
Eco130I CCWWGG 2 cut(s) 147, 223
Eco47I GGWCC 1 cut(s) 335
Eco57I CTGAAG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 2 cut(s) 147, 223
ErhI CCWWGG 2 cut(s) 147, 223
FaeI CATG 3 cut(s) 78, 227, 389
FaiI YATR 7 cut(s) 26, 76, 102, 191, 225, 380, 387
FaqI GGGAC 1 cut(s) 378
FatI CATG 3 cut(s) 74, 223, 385
FauI CCCGC 1 cut(s) 355
Fnu4HI GCNGC 5 cut(s) 12, 21, 97, 309, 360
Fsp4HI GCNGC 5 cut(s) 12, 21, 97, 309, 360
GluI GCNGC 5 cut(s) 12, 21, 97, 309, 360
HaeIII GGCC 2 cut(s) 168, 181
HapII CCGG 2 cut(s) 15, 84
Hin1II CATG 3 cut(s) 78, 227, 389
HinfI GANTC 2 cut(s) 28, 299
HpaII CCGG 2 cut(s) 15, 84
Hpy188I TCNGA 2 cut(s) 70, 335
Hpy188III TCNNGA 1 cut(s) 386
Hpy99I CGWCG 1 cut(s) 275
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4V TGCA 2 cut(s) 96, 193
HpyF10VI GCNNNNNNNGC 5 cut(s) 17, 20, 174, 178, 368
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 3 cut(s) 78, 227, 389
Kzo9I GATC 3 cut(s) 274, 372, 382
LmnI GCTCC 3 cut(s) 17, 86, 313
Lsp1109I GCAGC 3 cut(s) 7, 108, 371
LweI GCATC 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 227
MalI GATC 3 cut(s) 276, 374, 384
MboI GATC 3 cut(s) 274, 372, 382
MboII GAAGA 4 cut(s) 278, 295, 298, 367
MhlI GDGCHC 1 cut(s) 349
MluCI AATT 3 cut(s) 64, 139, 261
MnlI CCTC 3 cut(s) 37, 209, 341
MspA1I CMGCKG 1 cut(s) 362
MspI CCGG 2 cut(s) 15, 84
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
MwoI GCNNNNNNNGC 5 cut(s) 17, 20, 174, 178, 368
NcoI CCATGG 1 cut(s) 223
NdeII GATC 3 cut(s) 274, 372, 382
NlaIII CATG 3 cut(s) 78, 227, 389
NlaIV GGNNCC 3 cut(s) 156, 315, 337
NmuCI GTSAC 1 cut(s) 227
NspI RCATGY 1 cut(s) 78
PaeI GCATGC 1 cut(s) 78
PagI TCATGA 1 cut(s) 385
PfeI GAWTC 2 cut(s) 28, 299
PkrI GCNGC 5 cut(s) 13, 22, 98, 310, 361
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspN4I GGNNCC 3 cut(s) 156, 315, 337
PspPI GGNCC 1 cut(s) 335
SatI GCNGC 5 cut(s) 12, 21, 97, 309, 360
Sau3AI GATC 3 cut(s) 274, 372, 382
Sau96I GGNCC 1 cut(s) 335
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 349
SetI ASST 6 cut(s) 22, 101, 149, 201, 333, 393
SfaNI GCATC 1 cut(s) 164
SinI GGWCC 1 cut(s) 335
SphI GCATGC 1 cut(s) 78
Sse9I AATT 3 cut(s) 64, 139, 261
SsiI CCGC 6 cut(s) 9, 12, 113, 308, 311, 362
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 2 cut(s) 147, 223
TaaI ACNGT 1 cut(s) 207
TaqI TCGA 2 cut(s) 118, 132
TasI AATT 3 cut(s) 64, 139, 261
TauI GCSGC 2 cut(s) 14, 311
TfiI GAWTC 2 cut(s) 28, 299
TseFI GTSAC 1 cut(s) 227
TseI GCWGC 3 cut(s) 20, 96, 359
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 1 cut(s) 367
VpaK11BI GGWCC 1 cut(s) 335
XapI RAATTY 2 cut(s) 64, 139
XceI RCATGY 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.