Rroxscaffold_1G00008600

Nuclear chaperone required for maturation and nuclear export of pre-60S ribosome subunits

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
10879556 .. 10884737
5182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00008600.1

Sequence Viewer

Length: 273 bp
ATGTTACAAAGAACGTCAAGGGCAGACAATCTTGAGGTGATACCCTACATAGCAAGTGAGTACCAGAAAGATAAAATATGGCCAAGACGGACTCAGCCTAACAAACGTGATTATCAAGTTGTTATTGCTGTTAATGATTCCCACAGTATGTCTGAGAGTTGTTGTGGGGATGTTGCCATTGAAGCTCTGGTGACAGTGTGTAGTGCAATGTCACAACTAGAAAATATTGGCAACCTTGTTGTTGCAAGCTTTGGAAAGAAAGGCAAAACATAA

Protein Analysis

90

Amino Acids

10.01

Weight (kDa)

7.7

Isoelectric Point (pI)

53.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 80
AfaI GTAC 1 cut(s) 62
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 2 cut(s) 185, 249
AluI AGCT 2 cut(s) 185, 249
AoxI GGCC 1 cut(s) 80
AsuHPI GGTGA 2 cut(s) 49, 202
BalI TGGCCA 1 cut(s) 82
BfaI CTAG 1 cut(s) 218
BpuEI CTTGAG 1 cut(s) 53
Bse3DI GCAATG 1 cut(s) 213
BseGI GGATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 213
BseMII CTCAG 2 cut(s) 107, 144
BshFI GGCC 1 cut(s) 82
BsnI GGCC 1 cut(s) 82
BspANI GGCC 1 cut(s) 82
BspCNI CTCAG 2 cut(s) 106, 145
BsrDI GCAATG 1 cut(s) 213
Bst4CI ACNGT 2 cut(s) 146, 196
BstC8I GCNNGC 1 cut(s) 247
BstDEI CTNAG 2 cut(s) 93, 153
BstF5I GGATG 1 cut(s) 175
BstMWI GCNNNNNNNGC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 82
BtsCI GGATG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 201
Cac8I GCNNGC 1 cut(s) 247
Csp6I GTAC 1 cut(s) 61
CviJI RGCY 4 cut(s) 82, 97, 185, 249
CviKI_1 RGCY 4 cut(s) 82, 97, 185, 249
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 2 cut(s) 93, 153
EaeI YGGCCR 1 cut(s) 80
FaiI YATR 4 cut(s) 50, 79, 149, 271
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 218
HaeIII GGCC 1 cut(s) 82
HindIII AAGCTT 1 cut(s) 247
HinfI GANTC 2 cut(s) 91, 137
HphI GGTGA 2 cut(s) 49, 202
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4III ACNGT 2 cut(s) 146, 196
HpyCH4IV ACGT 2 cut(s) 14, 106
HpyCH4V TGCA 2 cut(s) 206, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HpyF3I CTNAG 2 cut(s) 93, 153
HpySE526I ACGT 2 cut(s) 14, 106
LpnPI CCDG 2 cut(s) 77, 173
MaeI CTAG 1 cut(s) 218
MaeII ACGT 2 cut(s) 14, 106
MaeIII GTNAC 3 cut(s) 3, 190, 210
MlsI TGGCCA 1 cut(s) 82
MluNI TGGCCA 1 cut(s) 82
MlyI GAGTC 1 cut(s) 85
MnlI CCTC 1 cut(s) 28
Mox20I TGGCCA 1 cut(s) 82
MscI TGGCCA 1 cut(s) 82
MseI TTAA 1 cut(s) 132
Msp20I TGGCCA 1 cut(s) 82
MwoI GCNNNNNNNGC 1 cut(s) 182
NmuCI GTSAC 2 cut(s) 190, 210
PfeI GAWTC 1 cut(s) 137
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
SaqAI TTAA 1 cut(s) 132
SchI GAGTC 1 cut(s) 85
SetI ASST 6 cut(s) 17, 39, 109, 187, 237, 251
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
SspI AATATT 1 cut(s) 226
SspMI CTAG 1 cut(s) 218
TaaI ACNGT 2 cut(s) 146, 196
TaiI ACGT 2 cut(s) 17, 109
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TscAI CASTG 1 cut(s) 201
TseFI GTSAC 2 cut(s) 190, 210
Tsp45I GTSAC 2 cut(s) 190, 210
TspGWI ACGGA 1 cut(s) 103
TspRI CASTG 1 cut(s) 201
XcmI CCANNNNNNNNNTGG 1 cut(s) 184
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.