RchiOBHm_Chr2g0151061

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002199
Physical Location & Seq
Reverse (-)
68710308 .. 68711499
1192 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52028

Sequence Viewer

Length: 123 bp
ATGACGCGGTCAACGGAGCTCATCACGACCCCGATGAAGGTCCCCAAGTCGCCGTATAAGGAAGTCACCTCAATTCTTTTAGCAGATGGAGTTGCAAGTGAAAAAATACAGAAGAATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.45

Weight (kDa)

9.3

Isoelectric Point (pI)

36.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 7
AciI CCGC 1 cut(s) 7
AcsI RAATTY 1 cut(s) 115
AfiI CCNNNNNNNGG 1 cut(s) 37
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
Alw21I GWGCWC 1 cut(s) 21
ApoI RAATTY 1 cut(s) 115
Asp700I GAANNNNTTC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 58
AvaII GGWCC 1 cut(s) 40
BanII GRGCYC 1 cut(s) 21
Bbv12I GWGCWC 1 cut(s) 21
BccI CCATC 1 cut(s) 80
BceAI ACGGC 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 37
Bsh1236I CGCG 1 cut(s) 7
BsiHKAI GWGCWC 1 cut(s) 21
BslFI GGGAC 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 26
Bsp1286I GDGCHC 1 cut(s) 21
BspACI CCGC 1 cut(s) 7
BspFNI CGCG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 42
BstFNI CGCG 1 cut(s) 7
BstUI CGCG 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 40
CseI GACGC 1 cut(s) 13
CviJI RGCY 1 cut(s) 19
CviKI_1 RGCY 1 cut(s) 19
Ecl136II GAGCTC 1 cut(s) 19
Eco24I GRGCYC 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 40
Eco53kI GAGCTC 1 cut(s) 19
EcoICRI GAGCTC 1 cut(s) 19
EcoO109I RGGNCCY 1 cut(s) 40
EcoT38I GRGCYC 1 cut(s) 21
FaiI YATR 1 cut(s) 57
FaqI GGGAC 1 cut(s) 26
FriOI GRGCYC 1 cut(s) 21
HgaI GACGC 1 cut(s) 13
HincII GTYRAC 1 cut(s) 12
HindII GTYRAC 1 cut(s) 12
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 95
LmnI GCTCC 1 cut(s) 16
MaeIII GTNAC 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 21
MluCI AATT 2 cut(s) 72, 115
MnlI CCTC 1 cut(s) 79
MroXI GAANNNNTTC 1 cut(s) 116
MvnI CGCG 1 cut(s) 7
NlaIV GGNNCC 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 64
PdmI GAANNNNTTC 1 cut(s) 116
PflFI GACNNNGTC 1 cut(s) 7
PpuMI RGGWCCY 1 cut(s) 40
Psp124BI GAGCTC 1 cut(s) 21
Psp5II RGGWCCY 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 42
PspPI GGNCC 1 cut(s) 40
PspPPI RGGWCCY 1 cut(s) 40
PsyI GACNNNGTC 1 cut(s) 7
SacI GAGCTC 1 cut(s) 21
Sau96I GGNCC 1 cut(s) 40
SduI GDGCHC 1 cut(s) 21
SetI ASST 3 cut(s) 21, 42, 71
SgeI CNNG 5 cut(s) 18, 37, 43, 58, 108
SinI GGWCC 1 cut(s) 40
Sse9I AATT 2 cut(s) 72, 115
SsiI CCGC 1 cut(s) 7
SstI GAGCTC 1 cut(s) 21
TasI AATT 2 cut(s) 72, 115
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 50
TspGWI ACGGA 1 cut(s) 29
Tth111I GACNNNGTC 1 cut(s) 7
VpaK11BI GGWCC 1 cut(s) 40
XapI RAATTY 1 cut(s) 115
XmnI GAANNNNTTC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.