Rh2BG316000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
37251158 .. 37274646
23489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG316000.1

Sequence Viewer

Length: 273 bp
ATGAAACCTGAAACACGATCAAAGAGGCCCCCAAGCGGGAGGTTCTCGCCGCAAACACGATCGACATCTGGCGTTTGTGTATTTGTCAATAATGGTGAAGAGGGTCGTCATTTCAGAGGTAGATATATCAAAGCACATCAATTACAACCGTTATATGTGACAGAGTTGCAAAAAAAGAAGAAAGAAAAAGAAATAACTGTGATTAGCTATAGTCCTACATGCAAACTGAGAATGAATAGCCCATCACAAATATCTTATAGCATCCTATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.41

Weight (kDa)

10.13

Isoelectric Point (pI)

65.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 36, 50
AfiI CCNNNNNNNGG 2 cut(s) 35, 36
AluBI AGCT 1 cut(s) 207
AluI AGCT 1 cut(s) 207
AoxI GGCC 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 107
BccI CCATC 1 cut(s) 250
BfmI CTRYAG 1 cut(s) 208
BisI GCNGC 1 cut(s) 50
BlsI GCNGC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 27
BmiI GGNNCC 1 cut(s) 29
BsaBI GATNNNNATC 1 cut(s) 64
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 36
Bse8I GATNNNNATC 1 cut(s) 64
BseGI GGATG 1 cut(s) 261
BseJI GATNNNNATC 1 cut(s) 64
BseLI CCNNNNNNNGG 2 cut(s) 35, 36
BseMII CTCAG 1 cut(s) 218
Bsh1285I CGRYCG 1 cut(s) 62
BshFI GGCC 1 cut(s) 28
BsiEI CGRYCG 1 cut(s) 62
BslI CCNNNNNNNGG 2 cut(s) 35, 36
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 2 cut(s) 17, 59
BspACI CCGC 2 cut(s) 36, 50
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 29
BssMI GATC 2 cut(s) 17, 59
Bst4CI ACNGT 2 cut(s) 150, 199
Bst6I CTCTTC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 227
BstF5I GGATG 1 cut(s) 261
BstKTI GATC 2 cut(s) 20, 62
BstMBI GATC 2 cut(s) 17, 59
BstMCI CGRYCG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 222
BstSFI CTRYAG 1 cut(s) 208
BsuRI GGCC 1 cut(s) 28
BtsCI GGATG 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 27
CviAII CATG 1 cut(s) 219
CviJI RGCY 3 cut(s) 28, 207, 240
CviKI_1 RGCY 3 cut(s) 28, 207, 240
DdeI CTNAG 1 cut(s) 227
DpnI GATC 2 cut(s) 19, 61
DpnII GATC 2 cut(s) 17, 59
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 27
FaeI CATG 1 cut(s) 222
FaiI YATR 7 cut(s) 126, 154, 156, 210, 220, 258, 268
FatI CATG 1 cut(s) 218
FauI CCCGC 1 cut(s) 29
Fnu4HI GCNGC 1 cut(s) 50
FokI GGATG 1 cut(s) 248
Fsp4HI GCNGC 1 cut(s) 50
GluI GCNGC 1 cut(s) 50
HaeIII GGCC 1 cut(s) 28
Hin1II CATG 1 cut(s) 222
HphI GGTGA 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 116
HpyCH4III ACNGT 2 cut(s) 150, 199
HpyCH4V TGCA 2 cut(s) 169, 222
HpyF3I CTNAG 1 cut(s) 227
Hsp92II CATG 1 cut(s) 222
Kzo9I GATC 2 cut(s) 17, 59
LpnPI CCDG 2 cut(s) 21, 54
MaeIII GTNAC 1 cut(s) 157
MalI GATC 2 cut(s) 19, 61
MboI GATC 2 cut(s) 17, 59
MboII GAAGA 2 cut(s) 110, 190
MluCI AATT 1 cut(s) 140
MnlI CCTC 4 cut(s) 18, 33, 94, 110
NdeII GATC 2 cut(s) 17, 59
NlaIII CATG 1 cut(s) 222
NlaIV GGNNCC 1 cut(s) 29
NmuCI GTSAC 1 cut(s) 157
NspI RCATGY 1 cut(s) 222
PkrI GCNGC 1 cut(s) 51
Ple19I CGATCG 1 cut(s) 62
PspN4I GGNNCC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 27
PvuI CGATCG 1 cut(s) 62
SatI GCNGC 1 cut(s) 50
Sau3AI GATC 2 cut(s) 17, 59
Sau96I GGNCC 1 cut(s) 27
SetI ASST 4 cut(s) 10, 44, 121, 209
SfcI CTRYAG 1 cut(s) 208
SgeI CNNG 8 cut(s) 20, 27, 45, 49, 58, 69, 81, 231
Sse9I AATT 1 cut(s) 140
SsiI CCGC 2 cut(s) 36, 50
TaaI ACNGT 2 cut(s) 150, 199
TaqI TCGA 1 cut(s) 62
TasI AATT 1 cut(s) 140
TauI GCSGC 1 cut(s) 52
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 17, 248
XceI RCATGY 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.