Rmu_sc0001311.1_g000004

Fruit protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001311.1
Physical Location & Seq
Reverse (-)
17186 .. 17646
461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001311.1_g000004.1.cds

Sequence Viewer

Length: 360 bp
atggggaaaggcttcgagattgatctgatcgaaccgctagagaattatcttaaggttctagttttcataacaggatatggaatcaggtctctgattgaatcaaggtttaatgttgataagggattcaatgtgaagctcttctatggggccagaaaccttgacagaatggcttatcaggtctgtaacaatgttgttcttgttcattttcatatgttttctagggttgcattttctttttcgatttgtgactacttttgtttgattgatgtctgcaatgtgtcttttgctttattttggttccaattgcaaagtggtttgaatgggcatgtaagagcgatgttccttgctggccaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

13.71

Weight (kDa)

6.81

Isoelectric Point (pI)

31.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AcoI YGGCCR 1 cut(s) 349
AflII CTTAAG 1 cut(s) 50
AgsI TTSAA 3 cut(s) 98, 127, 319
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 93
AoxI GGCC 2 cut(s) 147, 349
Asp700I GAANNNNTTC 2 cut(s) 11, 137
AspS9I GGNCC 1 cut(s) 147
BalI TGGCCA 1 cut(s) 351
BcoDI GTCTC 1 cut(s) 93
BfaI CTAG 3 cut(s) 38, 59, 219
BfrI CTTAAG 1 cut(s) 50
BmgT120I GGNCC 1 cut(s) 147
BmiI GGNNCC 2 cut(s) 148, 299
BsaI GGTCTC 1 cut(s) 93
Bse3DI GCAATG 1 cut(s) 280
BseMI GCAATG 1 cut(s) 280
BshFI GGCC 2 cut(s) 149, 351
BsmAI GTCTC 1 cut(s) 93
BsnI GGCC 2 cut(s) 149, 351
Bso31I GGTCTC 1 cut(s) 93
Bsp143I GATC 2 cut(s) 22, 27
BspACI CCGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 149, 351
BspLI GGNNCC 2 cut(s) 148, 299
BspQI GCTCTTC 1 cut(s) 143
BspTI CTTAAG 1 cut(s) 50
BspTNI GGTCTC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 280
BssMI GATC 2 cut(s) 22, 27
Bst6I CTCTTC 1 cut(s) 143
BstAFI CTTAAG 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 349
BstKTI GATC 2 cut(s) 25, 30
BstMAI GTCTC 1 cut(s) 93
BstMBI GATC 2 cut(s) 22, 27
BstNSI RCATGY 1 cut(s) 329
BsuRI GGCC 2 cut(s) 149, 351
BtgZI GCGATG 1 cut(s) 350
Cac8I GCNNGC 1 cut(s) 349
Cfr13I GGNCC 1 cut(s) 147
CviAII CATG 1 cut(s) 326
CviJI RGCY 5 cut(s) 12, 136, 149, 170, 351
CviKI_1 RGCY 5 cut(s) 12, 136, 149, 170, 351
DpnI GATC 2 cut(s) 24, 29
DpnII GATC 2 cut(s) 22, 27
EaeI YGGCCR 1 cut(s) 349
Eam1104I CTCTTC 1 cut(s) 143
EarI CTCTTC 1 cut(s) 143
Eco31I GGTCTC 1 cut(s) 93
FaeI CATG 1 cut(s) 329
FaiI YATR 6 cut(s) 68, 78, 144, 210, 212, 327
FatI CATG 1 cut(s) 325
FauNDI CATATG 1 cut(s) 210
FspBI CTAG 3 cut(s) 38, 59, 219
HaeIII GGCC 2 cut(s) 149, 351
Hin1II CATG 1 cut(s) 329
HinfI GANTC 3 cut(s) 81, 98, 123
Hpy188I TCNGA 2 cut(s) 27, 93
Hpy188III TCNNGA 1 cut(s) 16
HpyCH4V TGCA 3 cut(s) 227, 273, 307
Hsp92II CATG 1 cut(s) 329
Kzo9I GATC 2 cut(s) 22, 27
LguI GCTCTTC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 57, 70, 161, 163, 333
MaeI CTAG 3 cut(s) 38, 59, 219
MaeIII GTNAC 2 cut(s) 182, 245
MalI GATC 2 cut(s) 24, 29
MboI GATC 2 cut(s) 22, 27
MboII GAAGA 1 cut(s) 130
MfeI CAATTG 1 cut(s) 302
MlsI TGGCCA 1 cut(s) 351
MluCI AATT 2 cut(s) 43, 302
MluNI TGGCCA 1 cut(s) 351
Mox20I TGGCCA 1 cut(s) 351
MroXI GAANNNNTTC 2 cut(s) 11, 137
MscI TGGCCA 1 cut(s) 351
MseI TTAA 2 cut(s) 51, 108
Msp20I TGGCCA 1 cut(s) 351
MspCI CTTAAG 1 cut(s) 50
MunI CAATTG 1 cut(s) 302
NdeI CATATG 1 cut(s) 210
NdeII GATC 2 cut(s) 22, 27
NlaIII CATG 1 cut(s) 329
NlaIV GGNNCC 2 cut(s) 148, 299
NmuCI GTSAC 1 cut(s) 245
NspI RCATGY 1 cut(s) 329
PciSI GCTCTTC 1 cut(s) 143
PdmI GAANNNNTTC 2 cut(s) 11, 137
PfeI GAWTC 3 cut(s) 81, 98, 123
PspN4I GGNNCC 2 cut(s) 148, 299
PspPI GGNCC 1 cut(s) 147
SapI GCTCTTC 1 cut(s) 143
SaqAI TTAA 2 cut(s) 51, 108
Sau3AI GATC 2 cut(s) 22, 27
Sau96I GGNCC 1 cut(s) 147
SetI ASST 6 cut(s) 57, 89, 107, 138, 159, 180
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 2 cut(s) 43, 302
SsiI CCGC 1 cut(s) 35
SspMI CTAG 3 cut(s) 38, 59, 219
TaqI TCGA 3 cut(s) 15, 30, 239
TasI AATT 2 cut(s) 43, 302
TfiI GAWTC 3 cut(s) 81, 98, 123
Tru1I TTAA 2 cut(s) 51, 108
Tru9I TTAA 2 cut(s) 51, 108
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 3 cut(s) 55, 191, 197
Vha464I CTTAAG 1 cut(s) 50
XceI RCATGY 1 cut(s) 329
XcmI CCANNNNNNNNNTGG 1 cut(s) 308
XmnI GAANNNNTTC 2 cut(s) 11, 137
XspI CTAG 3 cut(s) 38, 59, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.