Rmu_sc0012206.1_g000005

Fruit protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012206.1
OG0002199
Physical Location & Seq
Forward (+)
24453 .. 25348
896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012206.1_g000005.1.cds

Sequence Viewer

Length: 378 bp
atggggaaaggcttcgagactgatcagatcgaaccgttggagaattatgctacggttctaattttcacaacgggatctggaatcagtccaatcaagtctctgattgaatcagggtttaatgttgataagggattcgacgtgaagctcttttatggggccagaaaccctttcagaatggcttatcaggatgttaaaaagatgaagatgaatcatggaggcaatactcagaccattgctgctgttgacccgaattcgcttgaggcccagtttgggattgattctggacctgcttctgaacctgcttctgcttttgggtttatgttatgttgtttggtaaattgtctaggaagtgcttttggtccaatttgcttctcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAD_binding_1

Protein Analysis

125

Amino Acids

13.39

Weight (kDa)

4.96

Isoelectric Point (pI)

36.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 295, 307
AclWI GGATC 1 cut(s) 82
AcsI RAATTY 1 cut(s) 250
AfiI CCNNNNNNNGG 1 cut(s) 270
AgsI TTSAA 1 cut(s) 107
AjiI CACGTC 1 cut(s) 139
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
Alw26I GTCTC 2 cut(s) 11, 102
AlwI GGATC 1 cut(s) 82
AoxI GGCC 2 cut(s) 156, 261
ApeKI GCWGC 1 cut(s) 236
ApoI RAATTY 1 cut(s) 250
Asp700I GAANNNNTTC 1 cut(s) 11
AspS9I GGNCC 4 cut(s) 156, 262, 284, 359
AvaII GGWCC 2 cut(s) 284, 359
BbvI GCAGC 1 cut(s) 223
BclI TGATCA 1 cut(s) 22
BcoDI GTCTC 2 cut(s) 11, 102
BfaI CTAG 2 cut(s) 344, 376
BfuAI ACCTGC 2 cut(s) 295, 307
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
Bme18I GGWCC 2 cut(s) 284, 359
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 4 cut(s) 156, 262, 284, 359
BmiI GGNNCC 1 cut(s) 157
BmrI ACTGGG 1 cut(s) 259
BmuI ACTGGG 1 cut(s) 259
BpuEI CTTGAG 1 cut(s) 278
Bsc4I CCNNNNNNNGG 1 cut(s) 270
Bse1I ACTGG 1 cut(s) 265
Bse3DI GCAATG 1 cut(s) 231
BseGI GGATG 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 270
BseMI GCAATG 1 cut(s) 231
BseMII CTCAG 1 cut(s) 239
BseNI ACTGG 1 cut(s) 265
BseXI GCAGC 1 cut(s) 223
BshFI GGCC 2 cut(s) 158, 263
BslI CCNNNNNNNGG 1 cut(s) 270
BsmAI GTCTC 2 cut(s) 11, 102
BsnI GGCC 2 cut(s) 158, 263
Bsp143I GATC 3 cut(s) 22, 27, 74
BspANI GGCC 2 cut(s) 158, 263
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 157
BspMI ACCTGC 2 cut(s) 295, 307
BspPI GGATC 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 231
BsrI ACTGG 1 cut(s) 265
BssMI GATC 3 cut(s) 22, 27, 74
Bst4CI ACNGT 2 cut(s) 36, 55
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 3 cut(s) 25, 30, 77
BstMAI GTCTC 2 cut(s) 11, 102
BstMBI GATC 3 cut(s) 22, 27, 74
BstV1I GCAGC 1 cut(s) 223
BstX2I RGATCY 1 cut(s) 74
BstYI RGATCY 1 cut(s) 74
BsuRI GGCC 2 cut(s) 158, 263
BtrI CACGTC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 193
BveI ACCTGC 2 cut(s) 295, 307
Cfr13I GGNCC 4 cut(s) 156, 262, 284, 359
CviAII CATG 1 cut(s) 212
CviJI RGCY 5 cut(s) 12, 145, 158, 179, 263
CviKI_1 RGCY 5 cut(s) 12, 145, 158, 179, 263
DdeI CTNAG 1 cut(s) 225
DpnI GATC 3 cut(s) 24, 29, 76
DpnII GATC 3 cut(s) 22, 27, 74
Eco47I GGWCC 2 cut(s) 284, 359
EcoRI GAATTC 1 cut(s) 250
FaeI CATG 1 cut(s) 215
FaiI YATR 5 cut(s) 48, 153, 213, 320, 325
FatI CATG 1 cut(s) 211
FbaI TGATCA 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 237
FokI GGATG 1 cut(s) 200
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 2 cut(s) 344, 376
GluI GCNGC 1 cut(s) 237
HaeIII GGCC 2 cut(s) 158, 263
Hin1II CATG 1 cut(s) 215
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HinfI GANTC 5 cut(s) 81, 107, 132, 208, 278
Hpy166II GTNNAC 1 cut(s) 244
Hpy188I TCNGA 5 cut(s) 27, 102, 173, 228, 295
Hpy188III TCNNGA 4 cut(s) 16, 78, 185, 282
Hpy8I GTNNAC 1 cut(s) 244
Hpy99I CGWCG 1 cut(s) 140
HpyCH4III ACNGT 2 cut(s) 36, 55
HpyCH4IV ACGT 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 225
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 215
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 3 cut(s) 22, 27, 74
LpnPI CCDG 8 cut(s) 63, 96, 170, 172, 267, 278, 300, 312
Lsp1109I GCAGC 1 cut(s) 223
MaeI CTAG 2 cut(s) 344, 376
MaeII ACGT 1 cut(s) 138
MalI GATC 3 cut(s) 24, 29, 76
MboI GATC 3 cut(s) 22, 27, 74
MboII GAAGA 1 cut(s) 214
MflI RGATCY 1 cut(s) 74
MluCI AATT 5 cut(s) 43, 60, 250, 337, 363
MmeI TCCRAC 1 cut(s) 18
MnlI CCTC 2 cut(s) 209, 253
MroXI GAANNNNTTC 1 cut(s) 11
MseI TTAA 2 cut(s) 117, 192
NdeII GATC 3 cut(s) 22, 27, 74
NlaIII CATG 1 cut(s) 215
NlaIV GGNNCC 1 cut(s) 157
PdmI GAANNNNTTC 1 cut(s) 11
PfeI GAWTC 5 cut(s) 81, 107, 132, 208, 278
PkrI GCNGC 1 cut(s) 238
PspN4I GGNNCC 1 cut(s) 157
PspPI GGNCC 4 cut(s) 156, 262, 284, 359
PsuI RGATCY 1 cut(s) 74
SaqAI TTAA 2 cut(s) 117, 192
SatI GCNGC 1 cut(s) 237
Sau3AI GATC 3 cut(s) 22, 27, 74
Sau96I GGNCC 4 cut(s) 156, 262, 284, 359
SetI ASST 4 cut(s) 141, 147, 289, 301
SinI GGWCC 2 cut(s) 284, 359
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
Sse9I AATT 5 cut(s) 43, 60, 250, 337, 363
SspMI CTAG 2 cut(s) 344, 376
TaaI ACNGT 2 cut(s) 36, 55
TaiI ACGT 1 cut(s) 141
TaqI TCGA 3 cut(s) 15, 30, 135
TasI AATT 5 cut(s) 43, 60, 250, 337, 363
TfiI GAWTC 5 cut(s) 81, 107, 132, 208, 278
Tru1I TTAA 2 cut(s) 117, 192
Tru9I TTAA 2 cut(s) 117, 192
TseI GCWGC 1 cut(s) 236
TspDTI ATGAA 2 cut(s) 215, 221
VpaK11BI GGWCC 2 cut(s) 284, 359
XapI RAATTY 1 cut(s) 250
XmnI GAANNNNTTC 1 cut(s) 11
XspI CTAG 2 cut(s) 344, 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.