Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005802.1

Orthogroup ID

OG0002199

Physical Location & Seq

Genomic Coordinates Forward (+)

73956 .. 78448

Gene Structure 4493 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005802.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 744 bp

atgcaacccttttatcttcatcgtcctcttccctcactcctcaatcttctcgcgaacagaacgcttttgcttcatggtccatcgttgagctgcttgtgcgggttgaagaagggggacgttgtggagctaacccaggatatggggaaaggcttcgagactaatcagatccaaccgttggaaaattatgctacggttctaattttcacaacgggatctggattcagtccaatcaggtctctgattgaatcagggtttaatgttgataagggattcgacgtgaagctcttttatggggccagaaaccttgacagaatggcttatcagaatggtgaagagggtcgtcatttcagaggtagaaatatcaaagcacatcaattacaaccgttatatgtgacagagttgcaaaagtttgtccatctttctcttggattttgctgtcatggaaaaggcggtcagcaagaggcggcatcgcccaaaggtgtaaaggctggatctgaggggatcagatgggattggagggattcgatctggtctgtgtcgcttggaaccttcaagtgcagaggagcggatgggagtggcggcgatgcttacaggtgtgttggggaggatggaaggatggaggggctgctagagttcgctcaatgtgggaggatggtagtcggtagtaggacggcgtggatctggtgtgctggacggtggcaagctgctcggttttcctctttggttgggctgactgggttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAD_binding_1

Protein Analysis

247

Amino Acids

27.27

Weight (kDa)

8.93

Isoelectric Point (pI)

36.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002199)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G15140 AT1G15140 AT1G15140
fragaria_vesca	FvH4_4g26280
malus_domestica	MD13G1031300.v1.1 MD16G1033500.v1.1
prunus_persica	Prupe.1G320800_v2.0.a1
pyrus_communis	pycom13g02740 pycom16g02810
rosa_chinensis	RchiOBHm_Chr2g0114941 RchiOBHm_Chr2g0123901 RchiOBHm_Chr2g0151061 RchiOBHm_Chr4g0433881 RchiOBHm_Chr6g0253871 RchiOBHm_Chr6g0284911 RchiOBHm_Chr7g0204021
rosa_laevigata	RLG00000006720 RLG00000013719 RLG00000029252 RLG00000034168
rosa_multiflora	Rmu_sc0000352.1_g000003 Rmu_sc0001311.1_g000004 Rmu_sc0002503.1_g000009 Rmu_sc0002892.1_g000030 Rmu_sc0004401.1_g000018 Rmu_sc0005802.1_g000017 Rmu_sc0012206.1_g000005 Rmu_sc0018346.1_g000012
rosa_roxburghii	Rroxscaffold_1G00042190 Rroxscaffold_3G00228970 Rroxscaffold_3G00244410 Rroxscaffold_4G00329490 Rroxscaffold_4G00329740 Rroxscaffold_5G00375280
rosa_rugosa	Rorug01G0076300 Rorug04G0272100 Rorug07G0031500
rosa_samantha	Rh2BG316000 Rh2CG609700 Rh4BG334200 Rh4CG350000 Rh5CG508600
rosa_wichuraiana	Rw4G028330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	139, 175
AccBSI	CCGCTC	1 cut(s)	566
AccII	CGCG	1 cut(s)	53
AciI	CCGC	5 cut(s)	99, 450, 464, 566, 579
AclWI	GGATC	5 cut(s)	160, 220, 499, 509, 686
AfiI	CCNNNNNNNGG	2 cut(s)	139, 175
AgsI	TTSAA	3 cut(s)	106, 245, 553
AjiI	CACGTC	1 cut(s)	277
AjnI	CCWGG	1 cut(s)	132
AluBI	AGCT	4 cut(s)	90, 127, 283, 704
AluI	AGCT	4 cut(s)	90, 127, 283, 704
Alw26I	GTCTC	2 cut(s)	149, 240
AlwI	GGATC	5 cut(s)	160, 220, 499, 509, 686
AoxI	GGCC	1 cut(s)	294
ApeKI	GCWGC	3 cut(s)	90, 625, 704
Asp700I	GAANNNNTTC	1 cut(s)	149
AspS9I	GGNCC	2 cut(s)	77, 294
AsuHPI	GGTGA	1 cut(s)	341
AvaII	GGWCC	1 cut(s)	77
BbvI	GCAGC	3 cut(s)	77, 612, 691
BccI	CCATC	7 cut(s)	88, 423, 501, 563, 602, 610, 646
BceAI	ACGGC	1 cut(s)	687
BcgI	CGANNNNNNTGC	2 cut(s)	689, 723
BciT130I	CCWGG	1 cut(s)	134
BcoDI	GTCTC	2 cut(s)	149, 240
BfaI	CTAG	1 cut(s)	629
BisI	GCNGC	5 cut(s)	91, 465, 580, 626, 705
BlsI	GCNGC	5 cut(s)	92, 466, 581, 627, 706
Bme1390I	CCNGG	1 cut(s)	134
Bme18I	GGWCC	1 cut(s)	77
BmgBI	CACGTC	1 cut(s)	277
BmgT120I	GGNCC	2 cut(s)	77, 294
BmiI	GGNNCC	2 cut(s)	295, 547
BmrFI	CCNGG	1 cut(s)	134
BmrI	ACTGGG	1 cut(s)	744
BmsI	GCATC	2 cut(s)	476, 574
BmuI	ACTGGG	1 cut(s)	744
BsaI	GGTCTC	1 cut(s)	240
BsaJI	CCNNGG	1 cut(s)	132
Bsc4I	CCNNNNNNNGG	2 cut(s)	139, 175
Bse1I	ACTGG	1 cut(s)	739
BseBI	CCWGG	1 cut(s)	134
BseDI	CCNNGG	1 cut(s)	132
BseGI	GGATG	4 cut(s)	574, 613, 621, 657
BseLI	CCNNNNNNNGG	2 cut(s)	139, 175
BseMII	CTCAG	1 cut(s)	486
BseNI	ACTGG	1 cut(s)	739
BseRI	GAGGAG	2 cut(s)	29, 576
BseXI	GCAGC	3 cut(s)	77, 612, 691
BsgI	GTGCAG	1 cut(s)	577
Bsh1236I	CGCG	1 cut(s)	53
BshFI	GGCC	1 cut(s)	296
BslFI	GGGAC	1 cut(s)	128
BslI	CCNNNNNNNGG	2 cut(s)	139, 175
BsmAI	GTCTC	2 cut(s)	149, 240
BsmFI	GGGAC	1 cut(s)	128
BsnI	GGCC	1 cut(s)	296
Bso31I	GGTCTC	1 cut(s)	240
Bsp143I	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
Bsp68I	TCGCGA	1 cut(s)	53
BspACI	CCGC	5 cut(s)	99, 450, 464, 566, 579
BspANI	GGCC	1 cut(s)	296
BspCNI	CTCAG	1 cut(s)	487
BspFNI	CGCG	1 cut(s)	53
BspLI	GGNNCC	2 cut(s)	295, 547
BspPI	GGATC	5 cut(s)	160, 220, 499, 509, 686
BspTNI	GGTCTC	1 cut(s)	240
BsrBI	CCGCTC	1 cut(s)	566
BsrI	ACTGG	1 cut(s)	739
BssECI	CCNNGG	1 cut(s)	132
BssMI	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
Bst2UI	CCWGG	1 cut(s)	134
Bst4CI	ACNGT	4 cut(s)	174, 193, 384, 696
Bst6I	CTCTTC	2 cut(s)	33, 327
BstC8I	GCNNGC	1 cut(s)	702
BstDEI	CTNAG	1 cut(s)	495
BstF5I	GGATG	4 cut(s)	574, 613, 621, 657
BstFNI	CGCG	1 cut(s)	53
BstKTI	GATC	6 cut(s)	168, 215, 494, 504, 528, 681
BstMAI	GTCTC	2 cut(s)	149, 240
BstMBI	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
BstMWI	GCNNNNNNNGC	1 cut(s)	96
BstNI	CCWGG	1 cut(s)	134
BstSCI	CCNGG	1 cut(s)	132
BstUI	CGCG	1 cut(s)	53
BstV1I	GCAGC	3 cut(s)	77, 612, 691
BstX2I	RGATCY	4 cut(s)	165, 212, 491, 678
BstYI	RGATCY	4 cut(s)	165, 212, 491, 678
BsuRI	GGCC	1 cut(s)	296
BtgZI	GCGATG	2 cut(s)	453, 597
BtrI	CACGTC	1 cut(s)	277
BtsCI	GGATG	4 cut(s)	574, 613, 621, 657
BtuMI	TCGCGA	1 cut(s)	53
Cac8I	GCNNGC	1 cut(s)	702
Cfr13I	GGNCC	2 cut(s)	77, 294
CviAII	CATG	2 cut(s)	74, 440
DdeI	CTNAG	1 cut(s)	495
DpnI	GATC	6 cut(s)	167, 214, 493, 503, 527, 680
DpnII	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
Eam1104I	CTCTTC	2 cut(s)	33, 327
EarI	CTCTTC	2 cut(s)	33, 327
Eco31I	GGTCTC	1 cut(s)	240
Eco47I	GGWCC	1 cut(s)	77
EcoRII	CCWGG	1 cut(s)	132
FaeI	CATG	2 cut(s)	77, 443
FaiI	YATR	7 cut(s)	75, 140, 186, 291, 388, 390, 441
FaqI	GGGAC	1 cut(s)	128
FatI	CATG	2 cut(s)	73, 439
FauI	CCCGC	1 cut(s)	92
Fnu4HI	GCNGC	5 cut(s)	91, 465, 580, 626, 705
FokI	GGATG	4 cut(s)	581, 620, 628, 664
Fsp4HI	GCNGC	5 cut(s)	91, 465, 580, 626, 705
FspBI	CTAG	1 cut(s)	629
GluI	GCNGC	5 cut(s)	91, 465, 580, 626, 705
HaeIII	GGCC	1 cut(s)	296
Hin1II	CATG	2 cut(s)	77, 443
HinfI	GANTC	4 cut(s)	219, 245, 270, 521
HphI	GGTGA	1 cut(s)	341
Hpy188I	TCNGA	6 cut(s)	165, 240, 324, 350, 496, 506
Hpy188III	TCNNGA	3 cut(s)	52, 154, 216
Hpy99I	CGWCG	1 cut(s)	278
HpyAV	CCTTC	3 cut(s)	103, 559, 606
HpyCH4III	ACNGT	4 cut(s)	174, 193, 384, 696
HpyCH4IV	ACGT	2 cut(s)	117, 276
HpyCH4V	TGCA	3 cut(s)	4, 403, 558
HpyF10VI	GCNNNNNNNGC	1 cut(s)	96
HpyF3I	CTNAG	1 cut(s)	495
HpySE526I	ACGT	2 cut(s)	117, 276
Hsp92II	CATG	2 cut(s)	77, 443
Kzo9I	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
LmnI	GCTCC	2 cut(s)	124, 563
Lsp1109I	GCAGC	3 cut(s)	77, 612, 691
LweI	GCATC	2 cut(s)	476, 574
MaeI	CTAG	1 cut(s)	629
MaeII	ACGT	2 cut(s)	117, 276
MaeIII	GTNAC	1 cut(s)	391
MalI	GATC	6 cut(s)	167, 214, 493, 503, 527, 680
MbiI	CCGCTC	1 cut(s)	566
MboI	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
MboII	GAAGA	5 cut(s)	8, 20, 38, 118, 344
MflI	RGATCY	4 cut(s)	165, 212, 491, 678
MluCI	AATT	3 cut(s)	181, 198, 374
MmeI	TCCRAC	2 cut(s)	156, 193
MroXI	GAANNNNTTC	1 cut(s)	149
MseI	TTAA	1 cut(s)	255
MspR9I	CCNGG	1 cut(s)	134
MvaI	CCWGG	1 cut(s)	134
MvnI	CGCG	1 cut(s)	53
MwoI	GCNNNNNNNGC	1 cut(s)	96
NdeII	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
NlaIII	CATG	2 cut(s)	77, 443
NlaIV	GGNNCC	2 cut(s)	295, 547
NmuCI	GTSAC	1 cut(s)	391
NruI	TCGCGA	1 cut(s)	53
PdmI	GAANNNNTTC	1 cut(s)	149
PfeI	GAWTC	4 cut(s)	219, 245, 270, 521
PflMI	CCANNNNNTGG	2 cut(s)	139, 175
PkrI	GCNGC	5 cut(s)	92, 466, 581, 627, 706
Psp6I	CCWGG	1 cut(s)	132
PspGI	CCWGG	1 cut(s)	132
PspN4I	GGNNCC	2 cut(s)	295, 547
PspPI	GGNCC	2 cut(s)	77, 294
PsuI	RGATCY	4 cut(s)	165, 212, 491, 678
RruI	TCGCGA	1 cut(s)	53
SaqAI	TTAA	1 cut(s)	255
SatI	GCNGC	5 cut(s)	91, 465, 580, 626, 705
Sau3AI	GATC	6 cut(s)	165, 212, 491, 501, 525, 678
Sau96I	GGNCC	2 cut(s)	77, 294
ScrFI	CCNGG	1 cut(s)	134
SfaNI	GCATC	2 cut(s)	476, 574
SinI	GGWCC	1 cut(s)	77
Sse9I	AATT	3 cut(s)	181, 198, 374
SsiI	CCGC	5 cut(s)	99, 450, 464, 566, 579
SspMI	CTAG	1 cut(s)	629
StyD4I	CCNGG	1 cut(s)	132
TaaI	ACNGT	4 cut(s)	174, 193, 384, 696
TaiI	ACGT	2 cut(s)	120, 279
TaqI	TCGA	3 cut(s)	153, 273, 524
TasI	AATT	3 cut(s)	181, 198, 374
TauI	GCSGC	2 cut(s)	467, 582
TfiI	GAWTC	4 cut(s)	219, 245, 270, 521
Tru1I	TTAA	1 cut(s)	255
Tru9I	TTAA	1 cut(s)	255
TseFI	GTSAC	1 cut(s)	391
TseI	GCWGC	3 cut(s)	90, 625, 704
Tsp45I	GTSAC	1 cut(s)	391
TspDTI	ATGAA	2 cut(s)	8, 62
Van91I	CCANNNNNTGG	2 cut(s)	139, 175
VpaK11BI	GGWCC	1 cut(s)	77
XcmI	CCANNNNNNNNNTGG	1 cut(s)	422
XmnI	GAANNNNTTC	1 cut(s)	149
XspI	CTAG	1 cut(s)	629

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.