Rh2CG609700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002199
Physical Location & Seq
Reverse (-)
78658410 .. 78658724
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG609700.1

Sequence Viewer

Length: 228 bp
ATGCCTGCAATGTGCCTTTTGCTTTATTTTAAGTATGGGTTTGTATGCTGCATTAATCGCGTTCGCCAAAAGTCAAACGACTGCAATAACAGGGCTTTTGATTTGAAGGATGTTAAAAAGATGAAGATGAATCATGGAGGCAATACTCAGACCATTGCTGCTATCGACCCGAATTTGCTTGAGGTGATTACCAACTCTTTCTCTATCAATCAAGCATTTTTGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.58

Weight (kDa)

9.07

Isoelectric Point (pI)

23.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 60
AcsI RAATTY 1 cut(s) 172
AgsI TTSAA 1 cut(s) 106
ApeKI GCWGC 2 cut(s) 48, 158
ApoI RAATTY 1 cut(s) 172
AseI ATTAAT 1 cut(s) 54
AsuHPI GGTGA 1 cut(s) 196
BbvI GCAGC 2 cut(s) 35, 145
BisI GCNGC 2 cut(s) 49, 159
BlsI GCNGC 2 cut(s) 50, 160
BpuEI CTTGAG 1 cut(s) 200
Bse3DI GCAATG 2 cut(s) 15, 153
BseGI GGATG 1 cut(s) 115
BseMI GCAATG 2 cut(s) 15, 153
BseMII CTCAG 1 cut(s) 161
BseXI GCAGC 2 cut(s) 35, 145
Bsh1236I CGCG 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 160
BspFNI CGCG 1 cut(s) 60
BsrDI GCAATG 2 cut(s) 15, 153
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 115
BstFNI CGCG 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstUI CGCG 1 cut(s) 60
BstV1I GCAGC 2 cut(s) 35, 145
BtsCI GGATG 1 cut(s) 115
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 134
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 1 cut(s) 147
FaeI CATG 1 cut(s) 137
FaiI YATR 3 cut(s) 36, 46, 135
FatI CATG 1 cut(s) 133
Fnu4HI GCNGC 2 cut(s) 49, 159
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 2 cut(s) 49, 159
GluI GCNGC 2 cut(s) 49, 159
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 130
HphI GGTGA 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 100
HpyCH4V TGCA 3 cut(s) 8, 51, 84
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 1 cut(s) 137
LpnPI CCDG 2 cut(s) 18, 76
Lsp1109I GCAGC 2 cut(s) 35, 145
MboII GAAGA 1 cut(s) 136
MluCI AATT 1 cut(s) 172
MnlI CCTC 2 cut(s) 131, 175
MseI TTAA 3 cut(s) 30, 54, 114
MvnI CGCG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 57
NlaIII CATG 1 cut(s) 137
PfeI GAWTC 1 cut(s) 130
PkrI GCNGC 2 cut(s) 50, 160
PshBI ATTAAT 1 cut(s) 54
SaqAI TTAA 3 cut(s) 30, 54, 114
SatI GCNGC 2 cut(s) 49, 159
SetI ASST 1 cut(s) 186
SgeI CNNG 7 cut(s) 17, 71, 103, 146, 181, 191, 224
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 1 cut(s) 172
TaqI TCGA 1 cut(s) 165
TasI AATT 1 cut(s) 172
TfiI GAWTC 1 cut(s) 130
Tru1I TTAA 3 cut(s) 30, 54, 114
Tru9I TTAA 3 cut(s) 30, 54, 114
TseI GCWGC 2 cut(s) 48, 158
TspDTI ATGAA 2 cut(s) 137, 143
VspI ATTAAT 1 cut(s) 54
XapI RAATTY 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.