RchiOBHm_Chr3g0461891
ERF Family

Gamma-interferon-inducible lysosomal thiol

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
9814241 .. 9814919
679 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42828

Sequence Viewer

Length: 294 bp
ATGTGCATTTTACATTCATCCACTGCGTTGAGAGGCTCACGTTGCAGAACAAACACAGTAAATGGGCCGATTGCTTTCAAAATGTCGAAGTTGGGGACTGTACCTATTGATTGCTACAACAGTGGATATGGCAATCAGGACTACAAAAATTTTATGGCCTATATCTGTAAGGCATACAAAGGAAAATCTCCAGAAGCTTGCAGATCAATTCGCTACAAGACTGAATCAATTGGAAATGAAAAATCAATTTCTCAAGTTTGCCTAGCAGAACAAGGAAGAAACTCTACATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.78

Weight (kDa)

9.36

Isoelectric Point (pI)

40.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AfaI GTAC 1 cut(s) 102
AgsI TTSAA 1 cut(s) 79
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
AoxI GGCC 2 cut(s) 65, 156
ApoI RAATTY 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 65
BarI GAAGNNNNNNTAC 1 cut(s) 268
BfaI CTAG 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 65
BpmI CTGGAG 1 cut(s) 174
BpuEI CTTGAG 1 cut(s) 237
BseGI GGATG 1 cut(s) 17
BshFI GGCC 2 cut(s) 67, 158
BslFI GGGAC 1 cut(s) 109
BsmFI GGGAC 1 cut(s) 109
BsnI GGCC 2 cut(s) 67, 158
Bsp143I GATC 1 cut(s) 203
BspANI GGCC 2 cut(s) 67, 158
BssMI GATC 1 cut(s) 203
Bst4CI ACNGT 3 cut(s) 58, 100, 122
BstC8I GCNNGC 1 cut(s) 199
BstF5I GGATG 1 cut(s) 17
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstMWI GCNNNNNNNGC 1 cut(s) 42
BsuRI GGCC 2 cut(s) 67, 158
BtsCI GGATG 1 cut(s) 17
BtsI GCAGTG 1 cut(s) 21
BtsIMutI CAGTG 2 cut(s) 21, 127
Cac8I GCNNGC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 101
CviJI RGCY 4 cut(s) 36, 67, 158, 197
CviKI_1 RGCY 4 cut(s) 36, 67, 158, 197
CviQI GTAC 1 cut(s) 101
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
FaiI YATR 5 cut(s) 129, 155, 162, 175, 289
FaqI GGGAC 1 cut(s) 109
FokI GGATG 1 cut(s) 4
FspBI CTAG 1 cut(s) 263
GsuI CTGGAG 1 cut(s) 174
HaeIII GGCC 2 cut(s) 67, 158
HindIII AAGCTT 1 cut(s) 195
HinfI GANTC 1 cut(s) 224
Hpy188III TCNNGA 2 cut(s) 137, 191
HpyCH4III ACNGT 3 cut(s) 58, 100, 122
HpyCH4IV ACGT 1 cut(s) 40
HpyCH4V TGCA 3 cut(s) 6, 45, 201
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 40
Kzo9I GATC 1 cut(s) 203
LpnPI CCDG 2 cut(s) 122, 204
MaeI CTAG 1 cut(s) 263
MaeII ACGT 1 cut(s) 40
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 1 cut(s) 288
MfeI CAATTG 1 cut(s) 228
MluCI AATT 4 cut(s) 148, 207, 228, 246
MnlI CCTC 1 cut(s) 26
MseI TTAA 1 cut(s) 292
MunI CAATTG 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 42
NdeII GATC 1 cut(s) 203
PfeI GAWTC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 65
RsaI GTAC 1 cut(s) 102
RsaNI GTAC 1 cut(s) 101
SaqAI TTAA 1 cut(s) 292
Sau3AI GATC 1 cut(s) 203
Sau96I GGNCC 1 cut(s) 65
SetI ASST 3 cut(s) 43, 106, 199
SgeI CNNG 8 cut(s) 51, 149, 203, 210, 229, 266, 275, 284
SmlI CTYRAG 1 cut(s) 252
SmoI CTYRAG 1 cut(s) 252
Sse9I AATT 4 cut(s) 148, 207, 228, 246
SspMI CTAG 1 cut(s) 263
TaaI ACNGT 3 cut(s) 58, 100, 122
TaiI ACGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 86
TasI AATT 4 cut(s) 148, 207, 228, 246
TfiI GAWTC 1 cut(s) 224
Tru1I TTAA 1 cut(s) 292
Tru9I TTAA 1 cut(s) 292
TscAI CASTG 2 cut(s) 28, 127
TspDTI ATGAA 2 cut(s) 6, 252
TspRI CASTG 2 cut(s) 28, 127
XapI RAATTY 1 cut(s) 148
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.