Rw0G007880
ERF Family

Gamma-interferon-inducible lysosomal thiol

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00290
Physical Location & Seq
Reverse (-)
17225 .. 17713
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G007880.1

Sequence Viewer

Length: 306 bp
ATGTCGAAGTTGGGGACTGTACCTATCGACTGCTACAACAGTGGATTTGGCAATCAGATTGAAACAAAATATGCAAAGGAAACTGCTCAGCTTAATCCACCACATAGATTTGTGCCATGGCTGGTTGTCAATAATAAACCACTTGCAGAGGACTACGGAAATTTTATGGCCTATATCTGTAAGGCATACAAAGGAAAATCTCCAGAAGCTTGCAGATCAATTCGCTACAAGACTGAATCAATTGGAAATGAAAAATCGATTCCTCAAGTTTGCCTAGCAGAACAAGGAAGAAACTCTACATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.37

Weight (kDa)

8.91

Isoelectric Point (pI)

46.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 160
AfaI GTAC 1 cut(s) 21
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 2 cut(s) 91, 209
AluI AGCT 2 cut(s) 91, 209
AoxI GGCC 1 cut(s) 168
ApoI RAATTY 1 cut(s) 160
BarI GAAGNNNNNNTAC 1 cut(s) 280
BfaI CTAG 1 cut(s) 275
BlpI GCTNAGC 1 cut(s) 87
BpmI CTGGAG 1 cut(s) 186
Bpu1102I GCTNAGC 1 cut(s) 87
BpuEI CTTGAG 1 cut(s) 249
Bsa29I ATCGAT 1 cut(s) 257
BsaJI CCNNGG 1 cut(s) 116
BseCI ATCGAT 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 101
BshFI GGCC 1 cut(s) 170
BshVI ATCGAT 1 cut(s) 257
BslFI GGGAC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 28
BsnI GGCC 1 cut(s) 170
Bsp143I GATC 1 cut(s) 215
Bsp1720I GCTNAGC 1 cut(s) 87
Bsp19I CCATGG 1 cut(s) 116
BspANI GGCC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 100
BspDI ATCGAT 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 215
BssT1I CCWWGG 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 19, 41
BstC8I GCNNGC 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 116
BstKTI GATC 1 cut(s) 218
BstMBI GATC 1 cut(s) 215
Bsu15I ATCGAT 1 cut(s) 257
BsuRI GGCC 1 cut(s) 170
BsuTUI ATCGAT 1 cut(s) 257
BtgI CCRYGG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 211
ClaI ATCGAT 1 cut(s) 257
Csp6I GTAC 1 cut(s) 20
CviAII CATG 1 cut(s) 117
CviJI RGCY 4 cut(s) 91, 121, 170, 209
CviKI_1 RGCY 4 cut(s) 91, 121, 170, 209
CviQI GTAC 1 cut(s) 20
DdeI CTNAG 1 cut(s) 87
DpnI GATC 1 cut(s) 217
DpnII GATC 1 cut(s) 215
Eco130I CCWWGG 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 116
ErhI CCWWGG 1 cut(s) 116
FaeI CATG 1 cut(s) 120
FaiI YATR 7 cut(s) 72, 105, 118, 167, 174, 187, 301
FaqI GGGAC 1 cut(s) 28
FatI CATG 1 cut(s) 116
FspBI CTAG 1 cut(s) 275
GsuI CTGGAG 1 cut(s) 186
HaeIII GGCC 1 cut(s) 170
Hin1II CATG 1 cut(s) 120
HindIII AAGCTT 1 cut(s) 207
HinfI GANTC 2 cut(s) 236, 259
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 203
HpyCH4III ACNGT 2 cut(s) 19, 41
HpyCH4V TGCA 3 cut(s) 74, 146, 213
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 1 cut(s) 120
Kzo9I GATC 1 cut(s) 215
LpnPI CCDG 2 cut(s) 107, 216
MaeI CTAG 1 cut(s) 275
MalI GATC 1 cut(s) 217
MboI GATC 1 cut(s) 215
MboII GAAGA 1 cut(s) 300
MfeI CAATTG 1 cut(s) 240
MluCI AATT 3 cut(s) 160, 219, 240
MnlI CCTC 2 cut(s) 142, 273
MseI TTAA 2 cut(s) 93, 304
MunI CAATTG 1 cut(s) 240
NcoI CCATGG 1 cut(s) 116
NdeII GATC 1 cut(s) 215
NlaIII CATG 1 cut(s) 120
PfeI GAWTC 2 cut(s) 236, 259
RsaI GTAC 1 cut(s) 21
RsaNI GTAC 1 cut(s) 20
SaqAI TTAA 2 cut(s) 93, 304
Sau3AI GATC 1 cut(s) 215
SetI ASST 3 cut(s) 25, 93, 211
SgeI CNNG 9 cut(s) 129, 134, 155, 215, 222, 241, 278, 287, 296
SmlI CTYRAG 1 cut(s) 264
SmoI CTYRAG 1 cut(s) 264
Sse9I AATT 3 cut(s) 160, 219, 240
SspMI CTAG 1 cut(s) 275
StyI CCWWGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 19, 41
TaqI TCGA 3 cut(s) 5, 27, 257
TasI AATT 3 cut(s) 160, 219, 240
TfiI GAWTC 2 cut(s) 236, 259
Tru1I TTAA 2 cut(s) 93, 304
Tru9I TTAA 2 cut(s) 93, 304
TscAI CASTG 1 cut(s) 46
TspDTI ATGAA 1 cut(s) 264
TspGWI ACGGA 1 cut(s) 171
TspRI CASTG 1 cut(s) 46
XapI RAATTY 1 cut(s) 160
XspI CTAG 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.