Rmu_sc0002003.1_g000003
ERF Family

Gamma-interferon-inducible lysosomal thiol

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002003.1
Physical Location & Seq
Forward (+)
23615 .. 24203
589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002003.1_g000003.1.cds

Sequence Viewer

Length: 366 bp
atgatgattcttttgaccctttttgtgcttaatttacagcatggaacagatgaatgcttgatcaacacaattgaggcctgcaccatcaccatctatcctaatgtgaatcggcattttacattcatcgactgcgttgagaggctcacgttgcagaacaaacacagtaaatgggccgattgctttgaaatgtcgaagttggggactgtacctatcgattgctacaacagtggatatggcaatcagattgaaacaaaatatgcaaaggaaactactcagcttaatccaccacatagatttgtgccgtggctggttgtcaatgataaaccacttgcagaggttagacaaatcacattccggattgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

14.0

Weight (kDa)

6.39

Isoelectric Point (pI)

42.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 354
AfaI GTAC 1 cut(s) 207
AgsI TTSAA 2 cut(s) 185, 248
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
Aor13HI TCCGGA 1 cut(s) 354
AoxI GGCC 2 cut(s) 75, 171
AspS9I GGNCC 1 cut(s) 171
AsuHPI GGTGA 1 cut(s) 79
BccI CCATC 2 cut(s) 92, 98
BceAI ACGGC 1 cut(s) 286
BclI TGATCA 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 213
BsaJI CCNNGG 1 cut(s) 302
BsaWI WCCGGW 1 cut(s) 354
BseAI TCCGGA 1 cut(s) 354
BseCI ATCGAT 1 cut(s) 213
BseDI CCNNGG 1 cut(s) 302
BseMII CTCAG 1 cut(s) 287
BsgI GTGCAG 1 cut(s) 64
BshFI GGCC 2 cut(s) 77, 173
BshVI ATCGAT 1 cut(s) 213
BsiSI CCGG 1 cut(s) 355
BslFI GGGAC 1 cut(s) 214
BsmFI GGGAC 1 cut(s) 214
BsmI GAATGC 1 cut(s) 59
BsnI GGCC 2 cut(s) 77, 173
Bsp13I TCCGGA 1 cut(s) 354
Bsp143I GATC 1 cut(s) 60
BspANI GGCC 2 cut(s) 77, 173
BspCNI CTCAG 1 cut(s) 286
BspDI ATCGAT 1 cut(s) 213
BspEI TCCGGA 1 cut(s) 354
BssECI CCNNGG 1 cut(s) 302
BssMI GATC 1 cut(s) 60
Bst4CI ACNGT 3 cut(s) 164, 205, 227
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 273
BstDSI CCRYGG 1 cut(s) 302
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 148
Bsu15I ATCGAT 1 cut(s) 213
BsuRI GGCC 2 cut(s) 77, 173
BsuTUI ATCGAT 1 cut(s) 213
BtgI CCRYGG 1 cut(s) 302
BtsIMutI CAGTG 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 171
ClaI ATCGAT 1 cut(s) 213
Csp6I GTAC 1 cut(s) 206
CviAII CATG 1 cut(s) 41
CviJI RGCY 5 cut(s) 77, 142, 173, 277, 307
CviKI_1 RGCY 5 cut(s) 77, 142, 173, 277, 307
CviQI GTAC 1 cut(s) 206
DdeI CTNAG 1 cut(s) 273
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco147I AGGCCT 1 cut(s) 77
FaeI CATG 1 cut(s) 44
FaiI YATR 4 cut(s) 42, 234, 258, 291
FaqI GGGAC 1 cut(s) 214
FatI CATG 1 cut(s) 40
FbaI TGATCA 1 cut(s) 60
HaeIII GGCC 2 cut(s) 77, 173
HapII CCGG 1 cut(s) 355
Hin1II CATG 1 cut(s) 44
HinfI GANTC 2 cut(s) 7, 106
HpaII CCGG 1 cut(s) 355
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 243
Hpy188III TCNNGA 1 cut(s) 355
HpyCH4III ACNGT 3 cut(s) 164, 205, 227
HpyCH4IV ACGT 1 cut(s) 146
HpyCH4V TGCA 4 cut(s) 81, 151, 260, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 273
HpySE526I ACGT 1 cut(s) 146
Hsp92II CATG 1 cut(s) 44
Kpn2I TCCGGA 1 cut(s) 354
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 91, 293
MaeII ACGT 1 cut(s) 146
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MfeI CAATTG 1 cut(s) 69
MluCI AATT 2 cut(s) 31, 69
MnlI CCTC 3 cut(s) 67, 132, 328
MroI TCCGGA 1 cut(s) 354
MseI TTAA 3 cut(s) 30, 279, 364
MspI CCGG 1 cut(s) 355
MunI CAATTG 1 cut(s) 69
Mva1269I GAATGC 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 1 cut(s) 60
NlaIII CATG 1 cut(s) 44
PceI AGGCCT 1 cut(s) 77
PctI GAATGC 1 cut(s) 59
PfeI GAWTC 2 cut(s) 7, 106
PspPI GGNCC 1 cut(s) 171
RsaI GTAC 1 cut(s) 207
RsaNI GTAC 1 cut(s) 206
SaqAI TTAA 3 cut(s) 30, 279, 364
Sau3AI GATC 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 171
SetI ASST 4 cut(s) 149, 211, 279, 339
SgeI CNNG 7 cut(s) 53, 70, 90, 157, 315, 320, 341
Sse9I AATT 2 cut(s) 31, 69
SseBI AGGCCT 1 cut(s) 77
StuI AGGCCT 1 cut(s) 77
TaaI ACNGT 3 cut(s) 164, 205, 227
TaiI ACGT 1 cut(s) 149
TaqI TCGA 3 cut(s) 126, 191, 213
TasI AATT 2 cut(s) 31, 69
TfiI GAWTC 2 cut(s) 7, 106
Tru1I TTAA 3 cut(s) 30, 279, 364
Tru9I TTAA 3 cut(s) 30, 279, 364
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 2 cut(s) 66, 112
TspRI CASTG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.