Rh4AG333400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0001585
Physical Location & Seq
Forward (+)
64292382 .. 64292931
550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG333400.1

Sequence Viewer

Length: 264 bp
ATGAGAAGGAGGAACGCAAATGTGCCAAAGCAGCTTCGAATAACAAAACCCCAGATTTCCAGATTTCCAGATTTCAAATTCAATCGAATCAATCCCTCAGTCGAACACTCATATCCAGCCTTCAATCCCATTCAAATGATTCAATCCCCTTCCAGATTTCAAATTCAATCCCTTAGTCCAACATTCGAACCCAGCCTTCAAGTCTCTTCGTCCTCCTCCGCCGCCGCTGCAAGTCTCTTCCAAGCAATCCAAATCTCCGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.85

Weight (kDa)

11.31

Isoelectric Point (pI)

81.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 219, 222, 225
AcsI RAATTY 2 cut(s) 77, 162
AgsI TTSAA 8 cut(s) 76, 82, 124, 134, 143, 161, 167, 200
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 2 cut(s) 208, 239
ApeKI GCWGC 2 cut(s) 31, 227
ApoI RAATTY 2 cut(s) 77, 162
AsuII TTCGAA 2 cut(s) 37, 186
BbvI GCAGC 2 cut(s) 43, 214
BcoDI GTCTC 2 cut(s) 208, 239
BisI GCNGC 4 cut(s) 32, 222, 225, 228
BlsI GCNGC 4 cut(s) 33, 223, 226, 229
Bpu14I TTCGAA 2 cut(s) 37, 186
BseMII CTCAG 1 cut(s) 111
BseRI GAGGAG 1 cut(s) 205
BseXI GCAGC 2 cut(s) 43, 214
BseYI CCCAGC 1 cut(s) 191
BsmAI GTCTC 2 cut(s) 208, 239
Bsp119I TTCGAA 2 cut(s) 37, 186
BspACI CCGC 3 cut(s) 219, 222, 225
BspCNI CTCAG 1 cut(s) 110
BspT104I TTCGAA 2 cut(s) 37, 186
Bst6I CTCTTC 2 cut(s) 211, 242
BstBI TTCGAA 2 cut(s) 37, 186
BstDEI CTNAG 2 cut(s) 97, 173
BstMAI GTCTC 2 cut(s) 208, 239
BstMWI GCNNNNNNNGC 2 cut(s) 31, 227
BstV1I GCAGC 2 cut(s) 43, 214
CviJI RGCY 3 cut(s) 34, 119, 195
CviKI_1 RGCY 3 cut(s) 34, 119, 195
DdeI CTNAG 2 cut(s) 97, 173
Eam1104I CTCTTC 2 cut(s) 211, 242
EarI CTCTTC 2 cut(s) 211, 242
EciI GGCGGA 1 cut(s) 208
FaiI YATR 1 cut(s) 112
Fnu4HI GCNGC 4 cut(s) 32, 222, 225, 228
Fsp4HI GCNGC 4 cut(s) 32, 222, 225, 228
GluI GCNGC 4 cut(s) 32, 222, 225, 228
GsaI CCCAGC 1 cut(s) 195
HinfI GANTC 2 cut(s) 87, 139
Hpy188I TCNGA 1 cut(s) 259
Hpy188III TCNNGA 3 cut(s) 60, 68, 153
HpyAV CCTTC 3 cut(s) 130, 159, 206
HpyCH4V TGCA 1 cut(s) 230
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 227
HpyF3I CTNAG 2 cut(s) 97, 173
LpnPI CCDG 6 cut(s) 65, 73, 81, 129, 166, 205
Lsp1109I GCAGC 2 cut(s) 43, 214
MboII GAAGA 2 cut(s) 198, 229
MluCI AATT 2 cut(s) 77, 162
MmeI TCCRAC 1 cut(s) 203
MnlI CCTC 4 cut(s) 3, 106, 223, 226
MslI CAYNNNNRTG 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 227
MwoI GCNNNNNNNGC 2 cut(s) 31, 227
NspV TTCGAA 2 cut(s) 37, 186
PfeI GAWTC 2 cut(s) 87, 139
PkrI GCNGC 4 cut(s) 33, 223, 226, 229
PspFI CCCAGC 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 134
SatI GCNGC 4 cut(s) 32, 222, 225, 228
SetI ASST 1 cut(s) 36
SfuI TTCGAA 2 cut(s) 37, 186
SgeI CNNG 9 cut(s) 64, 72, 80, 128, 165, 204, 212, 243, 254
SmiMI CAYNNNNRTG 1 cut(s) 134
Sse9I AATT 2 cut(s) 77, 162
SsiI CCGC 3 cut(s) 219, 222, 225
TaqI TCGA 4 cut(s) 37, 85, 102, 186
TasI AATT 2 cut(s) 77, 162
TauI GCSGC 2 cut(s) 224, 227
TfiI GAWTC 2 cut(s) 87, 139
TseI GCWGC 2 cut(s) 31, 227
XapI RAATTY 2 cut(s) 77, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.