RchiOBHm_Chr5g0025481

threonine-tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
19379015 .. 19382751
3737 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30512

Sequence Viewer

Length: 156 bp
ATGATACACAGAGCCATTTTGGGTTCTGTTAAGAGTATGTTTGCTATACTGCTGCATCACTACAATTGGAAATGGCTGCTCTGGCTTAGTCCACGTCAGGCAATTGTTTGCCCTGTCTTGGACAAATCCCAGCCCTATGCTCAACAGGTAGTTTGA

Protein Analysis

51

Amino Acids

5.99

Weight (kDa)

9.86

Isoelectric Point (pI)

64.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 118
AjiI CACGTC 1 cut(s) 95
ApeKI GCWGC 2 cut(s) 52, 76
BbvI GCAGC 2 cut(s) 39, 63
BisI GCNGC 2 cut(s) 53, 77
BlsI GCNGC 2 cut(s) 54, 78
BmgBI CACGTC 1 cut(s) 95
BmsI GCATC 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 118
BseXI GCAGC 2 cut(s) 39, 63
BseYI CCCAGC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 86
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstV1I GCAGC 2 cut(s) 39, 63
BtrI CACGTC 1 cut(s) 95
CviJI RGCY 4 cut(s) 14, 76, 85, 133
CviKI_1 RGCY 4 cut(s) 14, 76, 85, 133
DdeI CTNAG 1 cut(s) 86
FaiI YATR 3 cut(s) 38, 47, 138
Fnu4HI GCNGC 2 cut(s) 53, 77
Fsp4HI GCNGC 2 cut(s) 53, 77
GluI GCNGC 2 cut(s) 53, 77
GsaI CCCAGC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 92
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 86
HpySE526I ACGT 1 cut(s) 94
LpnPI CCDG 5 cut(s) 67, 83, 126, 131, 143
Lsp1109I GCAGC 2 cut(s) 39, 63
LweI GCATC 1 cut(s) 64
MaeII ACGT 1 cut(s) 94
MfeI CAATTG 2 cut(s) 64, 102
MluCI AATT 2 cut(s) 64, 102
MseI TTAA 1 cut(s) 30
MunI CAATTG 2 cut(s) 64, 102
MwoI GCNNNNNNNGC 1 cut(s) 82
PkrI GCNGC 2 cut(s) 54, 78
PspFI CCCAGC 1 cut(s) 129
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 2 cut(s) 53, 77
SetI ASST 2 cut(s) 97, 150
SfaNI GCATC 1 cut(s) 64
SgeI CNNG 6 cut(s) 94, 105, 110, 125, 130, 142
Sse9I AATT 2 cut(s) 64, 102
TaiI ACGT 1 cut(s) 97
TasI AATT 2 cut(s) 64, 102
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TseI GCWGC 2 cut(s) 52, 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.