Rh4AG411800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
71073305 .. 71075920
2616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG411800.1

Sequence Viewer

Length: 162 bp
ATGGCACATTACAACTACATTTTAGTTGTTGGTGACGATGAAGTCCAAACTGGACAGTTACAAGAGATGTTACTTATGAAGAATCCCCATCTGGACAGAGACTCACTTTTAGATCAGTCTCTCATCTGTCAAGAATTTGCTGAAAAGGAAGAAGCCTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.19

Weight (kDa)

4.21

Isoelectric Point (pI)

47.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 134
Alw26I GTCTC 2 cut(s) 93, 123
ApoI RAATTY 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 44
BccI CCATC 1 cut(s) 96
BcoDI GTCTC 2 cut(s) 93, 123
BfaI CTAG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 55
BsmAI GTCTC 2 cut(s) 93, 123
Bsp143I GATC 1 cut(s) 112
BsrI ACTGG 1 cut(s) 55
BssMI GATC 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 57
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 93, 123
BstMBI GATC 1 cut(s) 112
CviJI RGCY 1 cut(s) 155
CviKI_1 RGCY 1 cut(s) 155
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
DrdI GACNNNNNNGTC 1 cut(s) 41
DseDI GACNNNNNNGTC 1 cut(s) 41
FaiI YATR 1 cut(s) 77
FspBI CTAG 1 cut(s) 160
FspEI CC 8 cut(s) 15, 36, 59, 77, 99, 100, 101, 131
HinfI GANTC 2 cut(s) 82, 101
HphI GGTGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 92, 131
HpyCH4III ACNGT 1 cut(s) 57
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 36, 77
MaeI CTAG 1 cut(s) 160
MaeIII GTNAC 3 cut(s) 32, 57, 69
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 91, 161
MluCI AATT 1 cut(s) 134
MlyI GAGTC 1 cut(s) 95
NdeII GATC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 82
PleI GAGTC 1 cut(s) 95
PpsI GAGTC 1 cut(s) 95
Sau3AI GATC 1 cut(s) 112
SchI GAGTC 1 cut(s) 95
SgeI CNNG 4 cut(s) 63, 74, 104, 143
Sse9I AATT 1 cut(s) 134
SspMI CTAG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 57
TasI AATT 1 cut(s) 134
TfiI GAWTC 1 cut(s) 82
TseFI GTSAC 1 cut(s) 32
Tsp45I GTSAC 1 cut(s) 32
TspDTI ATGAA 2 cut(s) 54, 92
XapI RAATTY 1 cut(s) 134
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.