Rh7CG027000

threonine-tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
1959258 .. 1959410
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG027000.1

Sequence Viewer

Length: 153 bp
ATGGCTCAGTACAACTACATTCTAGTTGTTGGTGAGGAGGAAGTCAAAACTGGACAGGTGAGCGTACGGGTTAGAGATAAGGGAGCTTCCACAGTAATGAACATGGATAGCCTACTCAAACAATTCAAGGACAAAGTTGAAGCTTTTCATTAG

Protein Analysis

50

Amino Acids

5.69

Weight (kDa)

6.54

Isoelectric Point (pI)

14.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HGTP_anticodon PF03129 2 - 44 6.8e-09 Anticodon binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 11, 66
AgsI TTSAA 2 cut(s) 127, 140
AluBI AGCT 2 cut(s) 86, 143
AluI AGCT 2 cut(s) 86, 143
Asp700I GAANNNNTTC 1 cut(s) 144
AsuHPI GGTGA 2 cut(s) 44, 70
BfaI CTAG 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 50
BsiWI CGTACG 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 19
BsrI ACTGG 1 cut(s) 55
Bst4CI ACNGT 1 cut(s) 94
BstDEI CTNAG 1 cut(s) 6
Csp6I GTAC 2 cut(s) 10, 65
CviAII CATG 1 cut(s) 103
CviJI RGCY 4 cut(s) 5, 86, 111, 143
CviKI_1 RGCY 4 cut(s) 5, 86, 111, 143
CviQI GTAC 2 cut(s) 10, 65
DdeI CTNAG 1 cut(s) 6
FaeI CATG 1 cut(s) 106
FaiI YATR 1 cut(s) 104
FatI CATG 1 cut(s) 102
FspBI CTAG 1 cut(s) 23
Hin1II CATG 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 141
HphI GGTGA 2 cut(s) 44, 70
HpyCH4III ACNGT 1 cut(s) 94
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 106
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 2 cut(s) 36, 41
MaeI CTAG 1 cut(s) 23
MluCI AATT 1 cut(s) 122
MnlI CCTC 2 cut(s) 28, 31
MroXI GAANNNNTTC 1 cut(s) 144
MslI CAYNNNNRTG 1 cut(s) 95
NlaIII CATG 1 cut(s) 106
PdmI GAANNNNTTC 1 cut(s) 144
Pfl23II CGTACG 1 cut(s) 64
PspLI CGTACG 1 cut(s) 64
RsaI GTAC 2 cut(s) 11, 66
RsaNI GTAC 2 cut(s) 10, 65
RseI CAYNNNNRTG 1 cut(s) 95
SetI ASST 3 cut(s) 60, 88, 145
SgeI CNNG 6 cut(s) 35, 63, 68, 80, 115, 139
SmiMI CAYNNNNRTG 1 cut(s) 95
Sse9I AATT 1 cut(s) 122
SspMI CTAG 1 cut(s) 23
TaaI ACNGT 1 cut(s) 94
TasI AATT 1 cut(s) 122
TatI WGTACW 1 cut(s) 9
TspDTI ATGAA 2 cut(s) 113, 137
XmnI GAANNNNTTC 1 cut(s) 144
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.