RchiOBHm_Chr7g0230281

12-oxophytodienoate reductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
53722574 .. 53722845
272 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20633

Sequence Viewer

Length: 168 bp
ATGCAGTATTCAGATACTCCTGGTATATGGACAAGGGAGCAAGTTGAAGCATGGAAACCCATTGTCAATGCTGTACATGCTAAAGGGGGTGTCTTCTTTTGTCAGATTTGGCATGTGGGGAGGGTTTCAAATAGTGGTGCGTTCCTGACTTATACCTTTTTGACTTGA

Protein Analysis

55

Amino Acids

6.25

Weight (kDa)

7.96

Isoelectric Point (pI)

0.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxidored_FMN PF00724 3 - 44 4e-10 NADH:flavin oxidoreductase / NADH oxidase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 75
AgsI TTSAA 2 cut(s) 47, 129
AjnI CCWGG 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 85
BciT130I CCWGG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 85
BseBI CCWGG 1 cut(s) 21
Bsp1407I TGTACA 1 cut(s) 73
BsrGI TGTACA 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 21
BstAUI TGTACA 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNI CCWGG 1 cut(s) 21
BstNSI RCATGY 2 cut(s) 80, 116
BstSCI CCNGG 1 cut(s) 19
BstV2I GAAGAC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 74
CviAII CATG 3 cut(s) 51, 77, 113
CviQI GTAC 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 19
FaeI CATG 3 cut(s) 54, 80, 116
FaiI YATR 6 cut(s) 26, 28, 52, 78, 114, 153
FatI CATG 3 cut(s) 50, 76, 112
Hin1II CATG 3 cut(s) 54, 80, 116
Hpy188I TCNGA 2 cut(s) 13, 105
Hpy188III TCNNGA 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
Hsp92II CATG 3 cut(s) 54, 80, 116
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 6, 33, 158
MboII GAAGA 1 cut(s) 85
MnlI CCTC 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 77
NlaIII CATG 3 cut(s) 54, 80, 116
NspI RCATGY 2 cut(s) 80, 116
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 21
SetI ASST 1 cut(s) 158
SgeI CNNG 8 cut(s) 32, 33, 45, 53, 63, 89, 125, 157
StyD4I CCNGG 1 cut(s) 19
TatI WGTACW 1 cut(s) 73
XceI RCATGY 2 cut(s) 80, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.