Rmu_co8390375.1_g000001

12-oxophytodienoate reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8390375.1
Physical Location & Seq
Forward (+)
1 .. 864
864 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8390375.1_g000001.1.cds

Sequence Viewer

Length: 644 bp
gttttgatggaattgagatccatgcggcacacggctacctcattgatcaattcttaaaagatgggattaacgatcgaactgatgaatatggtgggtcgcttgcaaaccgttgcaaattcttgattcagattgttcaagcagtagttgaagccattggtgctaatagagttgccgtcagaatctcaccagctattgatttccatgatgctacggactccgacccaattggcctaggccttgcagtgattgacaagctcaatcagcttcaatacaacgtaggctcaaagctcgcttatctccatgtaactcagcctcgtttctttgctcaatacaacggaggcttggccgagtctgatcaagacacatttgctcaattcatgaggactttgcgagaatcttatcaaggtccattcatggctagtggagggtttacgagagaactaggaatggaaaccgtggcttccggtgatgctgatttagtgtcatatggccggaattttatctcaaaccctgacttggtgttgaggtttaagttgaatgctcccttgaacaagtatattagggagactttctacaccgatgaccctgtagttgggtacacagactacccttttctggacaaagaaagtgtgaaagaggattag

Protein Analysis

213

Amino Acids

23.74

Weight (kDa)

4.74

Isoelectric Point (pI)

21.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AclWI GGATC 1 cut(s) 12
AcoI YGGCCR 2 cut(s) 344, 489
AcsI RAATTY 2 cut(s) 115, 495
AfaI GTAC 1 cut(s) 598
AfiI CCNNNNNNNGG 3 cut(s) 516, 592, 615
AgsI TTSAA 5 cut(s) 136, 148, 268, 537, 549
AluBI AGCT 4 cut(s) 190, 255, 264, 288
AluI AGCT 4 cut(s) 190, 255, 264, 288
Alw26I GTCTC 1 cut(s) 559
AlwI GGATC 1 cut(s) 12
AoxI GGCC 4 cut(s) 228, 234, 344, 489
ApoI RAATTY 2 cut(s) 115, 495
AspA2I CCTAGG 1 cut(s) 231
AspS9I GGNCC 1 cut(s) 406
AsuHPI GGTGA 2 cut(s) 176, 478
AvaII GGWCC 1 cut(s) 406
AvrII CCTAGG 1 cut(s) 231
BccI CCATC 1 cut(s) 55
BceAI ACGGC 2 cut(s) 48, 157
BclI TGATCA 2 cut(s) 45, 354
BcoDI GTCTC 1 cut(s) 559
BfaI CTAG 3 cut(s) 232, 419, 442
BfmI CTRYAG 1 cut(s) 587
BisI GCNGC 1 cut(s) 26
BlnI CCTAGG 1 cut(s) 231
BlsI GCNGC 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 406
BmgT120I GGNCC 1 cut(s) 406
BmsI GCATC 2 cut(s) 195, 459
BsaJI CCNNGG 2 cut(s) 231, 455
BsaWI WCCGGW 1 cut(s) 463
Bsc4I CCNNNNNNNGG 3 cut(s) 516, 592, 615
BseDI CCNNGG 2 cut(s) 231, 455
BseLI CCNNNNNNNGG 3 cut(s) 516, 592, 615
BseMII CTCAG 1 cut(s) 322
Bsh1285I CGRYCG 1 cut(s) 75
BshFI GGCC 4 cut(s) 230, 236, 346, 491
BsiEI CGRYCG 1 cut(s) 75
BsiSI CCGG 2 cut(s) 464, 492
BslI CCNNNNNNNGG 3 cut(s) 516, 592, 615
BsmAI GTCTC 1 cut(s) 559
BsmI GAATGC 1 cut(s) 543
BsnI GGCC 4 cut(s) 230, 236, 346, 491
Bsp143I GATC 4 cut(s) 17, 45, 72, 354
BspACI CCGC 1 cut(s) 25
BspANI GGCC 4 cut(s) 230, 236, 346, 491
BspCNI CTCAG 1 cut(s) 321
BspHI TCATGA 1 cut(s) 377
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 2 cut(s) 231, 455
BssMI GATC 4 cut(s) 17, 45, 72, 354
BssT1I CCWWGG 1 cut(s) 231
Bst4CI ACNGT 2 cut(s) 109, 456
BstC8I GCNNGC 2 cut(s) 101, 290
BstDEI CTNAG 1 cut(s) 308
BstDSI CCRYGG 1 cut(s) 455
BstKTI GATC 4 cut(s) 20, 48, 75, 357
BstMAI GTCTC 1 cut(s) 559
BstMBI GATC 4 cut(s) 17, 45, 72, 354
BstMCI CGRYCG 1 cut(s) 75
BstMWI GCNNNNNNNGC 2 cut(s) 157, 261
BstSFI CTRYAG 1 cut(s) 587
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
BsuRI GGCC 4 cut(s) 230, 236, 346, 491
BtgI CCRYGG 1 cut(s) 455
BtsI GCAGTG 1 cut(s) 248
BtsIMutI CAGTG 1 cut(s) 248
Cac8I GCNNGC 2 cut(s) 101, 290
CciI TCATGA 1 cut(s) 377
Cfr13I GGNCC 1 cut(s) 406
Csp6I GTAC 1 cut(s) 597
CviAII CATG 5 cut(s) 22, 202, 301, 378, 414
CviQI GTAC 1 cut(s) 597
DdeI CTNAG 1 cut(s) 308
DpnI GATC 4 cut(s) 19, 47, 74, 356
DpnII GATC 4 cut(s) 17, 45, 72, 354
EaeI YGGCCR 2 cut(s) 344, 489
Eco130I CCWWGG 1 cut(s) 231
Eco147I AGGCCT 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 406
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 5 cut(s) 25, 205, 304, 381, 417
FaiI YATR 9 cut(s) 23, 89, 203, 302, 379, 415, 486, 488, 557
FatI CATG 5 cut(s) 21, 201, 300, 377, 413
FauNDI CATATG 1 cut(s) 486
FbaI TGATCA 2 cut(s) 45, 354
Fnu4HI GCNGC 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 26
FspBI CTAG 3 cut(s) 232, 419, 442
GluI GCNGC 1 cut(s) 26
HaeIII GGCC 4 cut(s) 230, 236, 346, 491
HapII CCGG 2 cut(s) 464, 492
Hin1II CATG 5 cut(s) 25, 205, 304, 381, 417
HinfI GANTC 5 cut(s) 123, 179, 214, 349, 394
HpaII CCGG 2 cut(s) 464, 492
HphI GGTGA 2 cut(s) 176, 478
Hpy166II GTNNAC 2 cut(s) 431, 599
Hpy188I TCNGA 4 cut(s) 128, 178, 219, 354
Hpy188III TCNNGA 4 cut(s) 120, 358, 378, 616
Hpy8I GTNNAC 2 cut(s) 431, 599
HpyCH4III ACNGT 2 cut(s) 109, 456
HpyCH4IV ACGT 1 cut(s) 275
HpyCH4V TGCA 3 cut(s) 103, 113, 241
HpyF10VI GCNNNNNNNGC 2 cut(s) 157, 261
HpyF3I CTNAG 1 cut(s) 308
HpySE526I ACGT 1 cut(s) 275
Hsp92II CATG 5 cut(s) 25, 205, 304, 381, 417
Ksp22I TGATCA 2 cut(s) 45, 354
Kzo9I GATC 4 cut(s) 17, 45, 72, 354
LmnI GCTCC 1 cut(s) 546
LpnPI CCDG 6 cut(s) 200, 477, 505, 524, 599, 601
LweI GCATC 2 cut(s) 195, 459
MaeI CTAG 3 cut(s) 232, 419, 442
MaeII ACGT 1 cut(s) 275
MaeIII GTNAC 1 cut(s) 303
MalI GATC 4 cut(s) 19, 47, 74, 356
MboI GATC 4 cut(s) 17, 45, 72, 354
MfeI CAATTG 1 cut(s) 224
MflI RGATCY 1 cut(s) 17
MluCI AATT 6 cut(s) 11, 49, 115, 224, 373, 495
MlyI GAGTC 2 cut(s) 208, 358
MmeI TCCRAC 1 cut(s) 242
MnlI CCTC 7 cut(s) 49, 323, 331, 374, 418, 518, 630
MseI TTAA 3 cut(s) 55, 68, 530
MspI CCGG 2 cut(s) 464, 492
MunI CAATTG 1 cut(s) 224
Mva1269I GAATGC 1 cut(s) 543
MwoI GCNNNNNNNGC 2 cut(s) 157, 261
NdeI CATATG 1 cut(s) 486
NdeII GATC 4 cut(s) 17, 45, 72, 354
NlaIII CATG 5 cut(s) 25, 205, 304, 381, 417
NmeAIII GCCGAG 1 cut(s) 372
PagI TCATGA 1 cut(s) 377
PceI AGGCCT 1 cut(s) 236
PctI GAATGC 1 cut(s) 543
PfeI GAWTC 3 cut(s) 123, 179, 394
PkrI GCNGC 1 cut(s) 27
Ple19I CGATCG 1 cut(s) 75
PleI GAGTC 2 cut(s) 208, 357
PpsI GAGTC 2 cut(s) 208, 357
PspPI GGNCC 1 cut(s) 406
PsuI RGATCY 1 cut(s) 17
PvuI CGATCG 1 cut(s) 75
RsaI GTAC 1 cut(s) 598
RsaNI GTAC 1 cut(s) 597
SaqAI TTAA 3 cut(s) 55, 68, 530
SatI GCNGC 1 cut(s) 26
Sau3AI GATC 4 cut(s) 17, 45, 72, 354
Sau96I GGNCC 1 cut(s) 406
SchI GAGTC 2 cut(s) 208, 358
SetI ASST 8 cut(s) 41, 192, 257, 266, 278, 290, 408, 529
SfaNI GCATC 2 cut(s) 195, 459
SfcI CTRYAG 1 cut(s) 587
SinI GGWCC 1 cut(s) 406
Sse9I AATT 6 cut(s) 11, 49, 115, 224, 373, 495
SseBI AGGCCT 1 cut(s) 236
SsiI CCGC 1 cut(s) 25
SspMI CTAG 3 cut(s) 232, 419, 442
StuI AGGCCT 1 cut(s) 236
StyI CCWWGG 1 cut(s) 231
TaaI ACNGT 2 cut(s) 109, 456
TaiI ACGT 1 cut(s) 278
TaqI TCGA 1 cut(s) 75
TasI AATT 6 cut(s) 11, 49, 115, 224, 373, 495
TauI GCSGC 1 cut(s) 28
TfiI GAWTC 3 cut(s) 123, 179, 394
Tru1I TTAA 3 cut(s) 55, 68, 530
Tru9I TTAA 3 cut(s) 55, 68, 530
TscAI CASTG 1 cut(s) 248
TspDTI ATGAA 3 cut(s) 98, 366, 402
TspGWI ACGGA 2 cut(s) 226, 350
TspRI CASTG 1 cut(s) 248
VpaK11BI GGWCC 1 cut(s) 406
XapI RAATTY 2 cut(s) 115, 495
XmaJI CCTAGG 1 cut(s) 231
XspI CTAG 3 cut(s) 232, 419, 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.