Rmu_sc0017068.1_g000001

12-oxophytodienoate reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017068.1
Physical Location & Seq
Forward (+)
1 .. 1195
1195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017068.1_g000001.1.cds

Sequence Viewer

Length: 169 bp
gtttccacatgttcctggaatttacacagatgaacaggttgaggcatggaagaaggtggtcgatgctgttcacgccaaaggtgccatcattttctgtcaactttggcatgtcggtcgtgcttctcatcaaggtaattttgtcacatacatgcttaaatggcagagctag

Protein Analysis

55

Amino Acids

6.33

Weight (kDa)

8.15

Isoelectric Point (pI)

22.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 19
AflIII ACRYGT 1 cut(s) 8
AjnI CCWGG 1 cut(s) 14
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
ApoI RAATTY 1 cut(s) 19
BanI GGYRCC 1 cut(s) 81
BccI CCATC 1 cut(s) 93
BcgI CGANNNNNNTGC 2 cut(s) 96, 130
BciT130I CCWGG 1 cut(s) 16
BfaI CTAG 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 16
BmiI GGNNCC 1 cut(s) 83
BmrFI CCNGG 1 cut(s) 16
BmsI GCATC 1 cut(s) 53
BseBI CCWGG 1 cut(s) 16
Bsh1285I CGRYCG 1 cut(s) 116
BshNI GGYRCC 1 cut(s) 81
BsiEI CGRYCG 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 83
BspT107I GGYRCC 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 16
BstMCI CGRYCG 1 cut(s) 116
BstMWI GCNNNNNNNGC 3 cut(s) 72, 81, 158
BstNI CCWGG 1 cut(s) 16
BstNSI RCATGY 3 cut(s) 12, 111, 152
BstSCI CCNGG 1 cut(s) 14
CviAII CATG 4 cut(s) 9, 46, 108, 149
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 14
FaeI CATG 4 cut(s) 12, 49, 111, 152
FaiI YATR 5 cut(s) 10, 47, 109, 146, 150
FatI CATG 4 cut(s) 8, 45, 107, 148
FspBI CTAG 1 cut(s) 167
Hin1II CATG 4 cut(s) 12, 49, 111, 152
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
Hpy166II GTNNAC 2 cut(s) 71, 99
Hpy8I GTNNAC 2 cut(s) 71, 99
HpyAV CCTTC 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 3 cut(s) 72, 81, 158
Hsp92II CATG 4 cut(s) 12, 49, 111, 152
LpnPI CCDG 2 cut(s) 21, 28
LweI GCATC 1 cut(s) 53
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 1 cut(s) 140
MboII GAAGA 1 cut(s) 62
MluCI AATT 2 cut(s) 19, 134
MnlI CCTC 1 cut(s) 35
MseI TTAA 1 cut(s) 154
MslI CAYNNNNRTG 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 16
MvaI CCWGG 1 cut(s) 16
MwoI GCNNNNNNNGC 3 cut(s) 72, 81, 158
NlaIII CATG 4 cut(s) 12, 49, 111, 152
NlaIV GGNNCC 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 140
NspI RCATGY 3 cut(s) 12, 111, 152
PciI ACATGT 1 cut(s) 8
PfoI TCCNGGA 1 cut(s) 14
PscI ACATGT 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 14
PspGI CCWGG 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 147
SaqAI TTAA 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 16
SetI ASST 5 cut(s) 40, 58, 83, 134, 168
SfaNI GCATC 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 147
Sse9I AATT 2 cut(s) 19, 134
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 14
TaqI TCGA 1 cut(s) 61
TaqII GACCGA 1 cut(s) 102
TasI AATT 2 cut(s) 19, 134
Tru1I TTAA 1 cut(s) 154
Tru9I TTAA 1 cut(s) 154
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
TspDTI ATGAA 1 cut(s) 46
XapI RAATTY 1 cut(s) 19
XceI RCATGY 3 cut(s) 12, 111, 152
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.