RLG00000032792

MAP kinase kinase kinase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0000922
Physical Location & Seq
Reverse (-)
19092435 .. 19095736
3302 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000032792

Sequence Viewer

Length: 897 bp
ATGGAAATGGAGGATGAAACCGTGACTATGTTGTTGGAATATGTCCCTGGTGGATCCATACAATCACTTCTCGAGAAATTTGGATCTTTCTCCATTCCTGTTGCTGCTTTCTTCTATTATGTGGGGACAACCAACTCTCATCCACCAATCCCTGAGCATCTTTCTTCTTCAGTGAAAGATTTTCTACAGGAATGTCTGCAAAAGGAACCAAATTTGAGGCCATCCGCATCTGAGCTGCTTAAGCATCCTTTTTTAACTGGGAAACAAGGGAAATCTCAGTCTGGTGGTCATACTGCTTCTATGGGGTGTCATGAAGTTATAAACCCCATCATGGAACTGGAAGGAGTGGTATCCATAGTGTCTGAAACATGTGATGAAGATATTGATAGCACTTGGAGCGACCATAGTTCCGACTCCAATAATCCAGCCGCTCACGCCAATAAACATATCTTTTCAATATTCTTTAGAAAGTTTAAGAGACCAACAATAACTCCTAGTCATGGATCTACAAAGGGCAAGTTCAGCTATGCATCTATCAAGTTGGCCACATGCAACTTCTCTGAGGAAAACAAGCTCGGACAAGGGGGCTTTGGATGTGTGTATAAGGTAATTAAGGGTTTAAAGAAAGGAATCTTGGAGACTGGACAACAGGTAGCTGTGAAAAGGCTTTCACTATATTCAGGGCAAGGATTTTCGGAGTTTAATAATGAACTGAGAACTATAGATGATCGGCCAACCATGTCAGATGTGATATCTATGCTGACAACTAAAAGTGTGCAATTACCTCTGCCAAAAAGGCCAGGATCTGTTGATGAAATTTCTGATTTTGATGGGGAAGGTGTGATGGGAGTGAGATCAGTGAGCGAAGAAGATGTGGGGACATTGTCTTTGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04010 ko04016 ko04722 ko04912 ko05166 map04010 map04016 map04722 map04912 map05166
Pfam Domains
Protein Families
Pkinase

Protein Analysis

299

Amino Acids

32.58

Weight (kDa)

5.43

Isoelectric Point (pI)

45.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 43 - 85 1.4e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 320
AccBSI CCGCTC 1 cut(s) 431
AciI CCGC 2 cut(s) 225, 429
AclWI GGATC 5 cut(s) 48, 61, 91, 511, 811
AcoI YGGCCR 2 cut(s) 543, 731
AcsI RAATTY 3 cut(s) 77, 211, 816
AcuI CTGAAG 1 cut(s) 153
AfiI CCNNNNNNNGG 2 cut(s) 331, 500
AflII CTTAAG 1 cut(s) 239
AflIII ACRYGT 1 cut(s) 368
AgsI TTSAA 1 cut(s) 456
AjnI CCWGG 2 cut(s) 46, 799
AjuI GAANNNNNNNTTGG 2 cut(s) 617, 649
AluBI AGCT 4 cut(s) 235, 525, 574, 656
AluI AGCT 4 cut(s) 235, 525, 574, 656
Alw26I GTCTC 2 cut(s) 472, 632
AlwI GGATC 5 cut(s) 48, 61, 91, 511, 811
AlwNI CAGNNNCTG 1 cut(s) 806
Ama87I CYCGRG 1 cut(s) 71
AoxI GGCC 4 cut(s) 218, 543, 731, 797
ApeKI GCWGC 2 cut(s) 104, 235
ApoI RAATTY 3 cut(s) 77, 211, 816
ArsI GACNNNNNNTTYG 1 cut(s) 871
AvaI CYCGRG 1 cut(s) 71
BalI TGGCCA 1 cut(s) 545
BamHI GGATCC 1 cut(s) 53
BbvI GCAGC 2 cut(s) 91, 222
BccI CCATC 4 cut(s) 229, 335, 824, 838
BciT130I CCWGG 2 cut(s) 48, 801
BciVI GTATCC 1 cut(s) 361
BcoDI GTCTC 2 cut(s) 472, 632
BfaI CTAG 1 cut(s) 495
BfmI CTRYAG 2 cut(s) 185, 720
BfrI CTTAAG 1 cut(s) 239
BfuI GTATCC 1 cut(s) 361
BglI GCCNNNNNGGC 1 cut(s) 796
BisI GCNGC 3 cut(s) 105, 236, 429
BlsI GCNGC 3 cut(s) 106, 237, 430
Bme1390I CCNGG 2 cut(s) 48, 801
BmeT110I CYCGRG 1 cut(s) 71
BmiI GGNNCC 2 cut(s) 55, 207
BmrFI CCNGG 2 cut(s) 48, 801
BmrI ACTGGG 1 cut(s) 267
BmsI GCATC 4 cut(s) 166, 236, 253, 539
BmuI ACTGGG 1 cut(s) 267
Bpu10I CCTNAGC 1 cut(s) 153
BsaI GGTCTC 1 cut(s) 472
BsaJI CCNNGG 1 cut(s) 46
BsaXI ACNNNNNCTCC 2 cut(s) 475, 505
Bsc4I CCNNNNNNNGG 2 cut(s) 331, 500
Bse1I ACTGG 3 cut(s) 262, 342, 646
BseBI CCWGG 2 cut(s) 48, 801
BseDI CCNNGG 1 cut(s) 46
BseGI GGATG 5 cut(s) 19, 139, 221, 244, 599
BseLI CCNNNNNNNGG 2 cut(s) 331, 500
BseMII CTCAG 5 cut(s) 144, 222, 290, 552, 704
BseNI ACTGG 3 cut(s) 262, 342, 646
BseXI GCAGC 2 cut(s) 91, 222
BshFI GGCC 4 cut(s) 220, 545, 733, 799
BsiHKCI CYCGRG 1 cut(s) 71
BslFI GGGAC 3 cut(s) 29, 139, 892
BslI CCNNNNNNNGG 2 cut(s) 331, 500
BsmAI GTCTC 2 cut(s) 472, 632
BsmFI GGGAC 3 cut(s) 29, 139, 892
BsnI GGCC 4 cut(s) 220, 545, 733, 799
Bso31I GGTCTC 1 cut(s) 472
BsoBI CYCGRG 1 cut(s) 71
Bsp143I GATC 6 cut(s) 53, 83, 503, 727, 803, 854
BspACI CCGC 2 cut(s) 225, 429
BspANI GGCC 4 cut(s) 220, 545, 733, 799
BspCNI CTCAG 5 cut(s) 145, 223, 289, 553, 705
BspHI TCATGA 1 cut(s) 310
BspLI GGNNCC 2 cut(s) 55, 207
BspPI GGATC 5 cut(s) 48, 61, 91, 511, 811
BspTI CTTAAG 1 cut(s) 239
BspTNI GGTCTC 1 cut(s) 472
BsrBI CCGCTC 1 cut(s) 431
BsrI ACTGG 3 cut(s) 262, 342, 646
BssECI CCNNGG 1 cut(s) 46
BssMI GATC 6 cut(s) 53, 83, 503, 727, 803, 854
Bst2UI CCWGG 2 cut(s) 48, 801
Bst4CI ACNGT 1 cut(s) 22
BstAFI CTTAAG 1 cut(s) 239
BstDEI CTNAG 5 cut(s) 153, 231, 276, 561, 713
BstF5I GGATG 5 cut(s) 19, 139, 221, 244, 599
BstKTI GATC 6 cut(s) 56, 86, 506, 730, 806, 857
BstMAI GTCTC 2 cut(s) 472, 632
BstMBI GATC 6 cut(s) 53, 83, 503, 727, 803, 854
BstMWI GCNNNNNNNGC 5 cut(s) 241, 396, 434, 522, 796
BstNI CCWGG 2 cut(s) 48, 801
BstNSI RCATGY 2 cut(s) 372, 552
BstSCI CCNGG 2 cut(s) 46, 799
BstSFI CTRYAG 2 cut(s) 185, 720
BstV1I GCAGC 2 cut(s) 91, 222
BstX2I RGATCY 4 cut(s) 53, 83, 503, 803
BstYI RGATCY 4 cut(s) 53, 83, 503, 803
BsuI GTATCC 1 cut(s) 361
BsuRI GGCC 4 cut(s) 220, 545, 733, 799
BtsCI GGATG 5 cut(s) 19, 139, 221, 244, 599
BtsIMutI CAGTG 2 cut(s) 177, 864
CaiI CAGNNNCTG 1 cut(s) 806
CciI TCATGA 1 cut(s) 310
CviAII CATG 6 cut(s) 311, 331, 369, 500, 549, 739
DdeI CTNAG 5 cut(s) 153, 231, 276, 561, 713
DpnI GATC 6 cut(s) 55, 85, 505, 729, 805, 856
DpnII GATC 6 cut(s) 53, 83, 503, 727, 803, 854
DraI TTTAAA 1 cut(s) 621
EaeI YGGCCR 2 cut(s) 543, 731
Eco31I GGTCTC 1 cut(s) 472
Eco32I GATATC 1 cut(s) 753
Eco57I CTGAAG 1 cut(s) 153
Eco88I CYCGRG 1 cut(s) 71
EcoRII CCWGG 2 cut(s) 46, 799
EcoRV GATATC 1 cut(s) 753
EcoT22I ATGCAT 1 cut(s) 532
FaeI CATG 6 cut(s) 314, 334, 372, 503, 552, 742
FaqI GGGAC 3 cut(s) 29, 139, 892
FatI CATG 6 cut(s) 310, 330, 368, 499, 548, 738
Fnu4HI GCNGC 3 cut(s) 105, 236, 429
FokI GGATG 5 cut(s) 26, 126, 208, 231, 606
Fsp4HI GCNGC 3 cut(s) 105, 236, 429
FspBI CTAG 1 cut(s) 495
GluI GCNGC 3 cut(s) 105, 236, 429
HaeIII GGCC 4 cut(s) 220, 545, 733, 799
Hin1II CATG 6 cut(s) 314, 334, 372, 503, 552, 742
HinfI GANTC 2 cut(s) 413, 630
Hpy188I TCNGA 8 cut(s) 232, 364, 412, 562, 578, 697, 745, 823
Hpy188III TCNNGA 3 cut(s) 71, 73, 311
HpyAV CCTTC 2 cut(s) 335, 830
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 4 cut(s) 199, 530, 552, 778
HpyF10VI GCNNNNNNNGC 5 cut(s) 241, 396, 434, 522, 796
HpyF3I CTNAG 5 cut(s) 153, 231, 276, 561, 713
Hsp92II CATG 6 cut(s) 314, 334, 372, 503, 552, 742
Kzo9I GATC 6 cut(s) 53, 83, 503, 727, 803, 854
LmnI GCTCC 1 cut(s) 396
Lsp1109I GCAGC 2 cut(s) 91, 222
LweI GCATC 4 cut(s) 166, 236, 253, 539
MaeI CTAG 1 cut(s) 495
MaeIII GTNAC 1 cut(s) 22
MalI GATC 6 cut(s) 55, 85, 505, 729, 805, 856
MbiI CCGCTC 1 cut(s) 431
MboI GATC 6 cut(s) 53, 83, 503, 727, 803, 854
MboII GAAGA 6 cut(s) 103, 156, 159, 389, 878, 881
MflI RGATCY 4 cut(s) 53, 83, 503, 803
MlsI TGGCCA 1 cut(s) 545
MluCI AATT 5 cut(s) 77, 211, 609, 779, 816
MluNI TGGCCA 1 cut(s) 545
MlyI GAGTC 1 cut(s) 407
MmeI TCCRAC 2 cut(s) 15, 435
MnlI CCTC 4 cut(s) 4, 210, 556, 795
Mox20I TGGCCA 1 cut(s) 545
Mph1103I ATGCAT 1 cut(s) 532
MscI TGGCCA 1 cut(s) 545
MseI TTAA 6 cut(s) 240, 254, 474, 612, 620, 702
Msp20I TGGCCA 1 cut(s) 545
MspCI CTTAAG 1 cut(s) 239
MspR9I CCNGG 2 cut(s) 48, 801
MvaI CCWGG 2 cut(s) 48, 801
MwoI GCNNNNNNNGC 5 cut(s) 241, 396, 434, 522, 796
NdeII GATC 6 cut(s) 53, 83, 503, 727, 803, 854
NlaIII CATG 6 cut(s) 314, 334, 372, 503, 552, 742
NlaIV GGNNCC 2 cut(s) 55, 207
NmuCI GTSAC 1 cut(s) 22
NsiI ATGCAT 1 cut(s) 532
NspI RCATGY 2 cut(s) 372, 552
PaeR7I CTCGAG 1 cut(s) 71
PagI TCATGA 1 cut(s) 310
PciI ACATGT 1 cut(s) 368
PfeI GAWTC 1 cut(s) 630
PflFI GACNNNGTC 1 cut(s) 883
PkrI GCNGC 3 cut(s) 106, 237, 430
PleI GAGTC 1 cut(s) 407
PpsI GAGTC 1 cut(s) 407
PscI ACATGT 1 cut(s) 368
PsiI TTATAA 1 cut(s) 320
Psp6I CCWGG 2 cut(s) 46, 799
PspGI CCWGG 2 cut(s) 46, 799
PspN4I GGNNCC 2 cut(s) 55, 207
PstNI CAGNNNCTG 1 cut(s) 806
PsuI RGATCY 4 cut(s) 53, 83, 503, 803
PsyI GACNNNGTC 1 cut(s) 883
SaqAI TTAA 6 cut(s) 240, 254, 474, 612, 620, 702
SatI GCNGC 3 cut(s) 105, 236, 429
Sau3AI GATC 6 cut(s) 53, 83, 503, 727, 803, 854
SchI GAGTC 1 cut(s) 407
ScrFI CCNGG 2 cut(s) 48, 801
SetI ASST 8 cut(s) 237, 527, 576, 609, 654, 658, 787, 841
SfaNI GCATC 4 cut(s) 166, 236, 253, 539
SfcI CTRYAG 2 cut(s) 185, 720
Sfr274I CTCGAG 1 cut(s) 71
SlaI CTCGAG 1 cut(s) 71
SmlI CTYRAG 2 cut(s) 71, 239
SmoI CTYRAG 2 cut(s) 71, 239
Sse9I AATT 5 cut(s) 77, 211, 609, 779, 816
SsiI CCGC 2 cut(s) 225, 429
SspI AATATT 1 cut(s) 459
SspMI CTAG 1 cut(s) 495
StyD4I CCNGG 2 cut(s) 46, 799
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 72
TasI AATT 5 cut(s) 77, 211, 609, 779, 816
TauI GCSGC 1 cut(s) 431
TfiI GAWTC 1 cut(s) 630
Tru1I TTAA 6 cut(s) 240, 254, 474, 612, 620, 702
Tru9I TTAA 6 cut(s) 240, 254, 474, 612, 620, 702
TscAI CASTG 2 cut(s) 177, 864
TseFI GTSAC 1 cut(s) 22
TseI GCWGC 2 cut(s) 104, 235
Tsp45I GTSAC 1 cut(s) 22
TspDTI ATGAA 5 cut(s) 30, 327, 390, 723, 828
TspRI CASTG 2 cut(s) 177, 864
Tth111I GACNNNGTC 1 cut(s) 883
Vha464I CTTAAG 1 cut(s) 239
XapI RAATTY 3 cut(s) 77, 211, 816
XceI RCATGY 2 cut(s) 372, 552
XcmI CCANNNNNNNNNTGG 1 cut(s) 334
XhoI CTCGAG 1 cut(s) 71
XspI CTAG 1 cut(s) 495
Zsp2I ATGCAT 1 cut(s) 532
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.