Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015218.1

Orthogroup ID

OG0000922

Physical Location & Seq

Genomic Coordinates Forward (+)

7819 .. 8423

Gene Structure 605 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015218.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

atggctcctgagtacgcatccttgggaatttttggagtaaaatctgatgtctttagttttggagtggcaatgcttcaaattttaagtggtagaagtagaagatattctgacttctccaaaactcttgcctgggatctaccagtctatgcatgggagttgtggaaaaaaggtgcagggctagaactaatggatccaatgctaggcaattcttgtattaacaaagatcaattcttaagatgcttgcatgttggtctactatgtgtggaggcaaatgcagatgatcggccaaccatgtcagatgtgatatctatgttgacaattaaaagtgtgcaattacctctgccaaaaaggccaggatctgttgatgaaatttctgattttgatggggaaggtgtgatgggagtgagatcagtgagcgaagaagatgtggggacagtctttggaatgatggagatcctggaaaggtggacattatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002376 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006952 GO:0006955 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009620 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043207 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0045087 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr

Protein Analysis

158

Amino Acids

17.53

Weight (kDa)

4.68

Isoelectric Point (pI)

50.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000922)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09000 AT1G09000 AT1G54960 AT1G54960
fragaria_vesca	FvH4_2g08110 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14780 FvH4_3g14790 FvH4_4g12990 FvH4_4g34210 FvH4_6g05800 FvH4_6g05800
malus_domestica	MD04G1205500.v1.1 MD12G1219600.v1.1
prunus_persica	Prupe.6G326300_v2.0.a1 Prupe.6G326300_v2.0.a1 Prupe.6G326300_v2.0.a1
pyrus_communis	pycom04g18180 pycom12g20510
rosa_chinensis	RchiOBHm_Chr3g0454721 RchiOBHm_Chr5g0024321 RchiOBHm_Chr5g0024331 RchiOBHm_Chr5g0024401 RchiOBHm_Chr5g0025361
rosa_laevigata	RLG00000032792 RLG00000032796
rosa_multiflora	Rmu_co7974142.1_g000001 Rmu_co8231501.1_g000001 Rmu_co8476593.1_g000001 Rmu_sc0005861.1_g000005 Rmu_sc0014903.1_g000002 Rmu_sc0015218.1_g000003
rosa_roxburghii	Rroxscaffold_1G00054820 Rroxscaffold_1G00054830 Rroxscaffold_1G00055870 Rroxscaffold_6G00424830
rosa_rugosa	Rorug03G0001600 Rorug05G0083100
rosa_samantha	Rh3AG061400 Rh3AG061600 Rh3BG063200 Rh3BG063400 Rh3CG062100 Rh3CG062300 Rh3DG063100 Rh5AG173900 Rh5AG174200 Rh5BG171100 Rh5BG171800 Rh5CG187000 Rh5CG187100 Rh5CG187200 Rh5DG173300 Rh5DG245400
rosa_wichuraiana	Rw3G004800 Rw5G015780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	253
AclWI	GGATC	5 cut(s)	141, 185, 198, 364, 448
AcoI	YGGCCR	1 cut(s)	284
AcsI	RAATTY	3 cut(s)	27, 78, 369
AfaI	GTAC	1 cut(s)	14
AfiI	CCNNNNNNNGG	1 cut(s)	200
AflII	CTTAAG	1 cut(s)	232
AgsI	TTSAA	1 cut(s)	77
AjnI	CCWGG	3 cut(s)	128, 352, 456
AlwI	GGATC	5 cut(s)	141, 185, 198, 364, 448
AlwNI	CAGNNNCTG	1 cut(s)	359
AoxI	GGCC	2 cut(s)	284, 350
ApoI	RAATTY	3 cut(s)	27, 78, 369
Asp700I	GAANNNNTTC	1 cut(s)	103
BamHI	GGATCC	1 cut(s)	190
BccI	CCATC	3 cut(s)	377, 391, 442
BciT130I	CCWGG	3 cut(s)	130, 354, 458
BfaI	CTAG	2 cut(s)	179, 200
BfrI	CTTAAG	1 cut(s)	232
BglI	GCCNNNNNGGC	1 cut(s)	349
Bme1390I	CCNGG	3 cut(s)	130, 354, 458
BmiI	GGNNCC	2 cut(s)	6, 192
BmrFI	CCNGG	3 cut(s)	130, 354, 458
BmsI	GCATC	2 cut(s)	26, 227
BsaBI	GATNNNNATC	1 cut(s)	452
BsaJI	CCNNGG	2 cut(s)	21, 129
Bsc4I	CCNNNNNNNGG	1 cut(s)	200
Bse1I	ACTGG	1 cut(s)	140
Bse3DI	GCAATG	1 cut(s)	75
Bse8I	GATNNNNATC	1 cut(s)	452
BseBI	CCWGG	3 cut(s)	130, 354, 458
BseDI	CCNNGG	2 cut(s)	21, 129
BseGI	GGATG	1 cut(s)	17
BseJI	GATNNNNATC	1 cut(s)	452
BseLI	CCNNNNNNNGG	1 cut(s)	200
BseMI	GCAATG	1 cut(s)	75
BseNI	ACTGG	1 cut(s)	140
BsgI	GTGCAG	1 cut(s)	192
BshFI	GGCC	2 cut(s)	286, 352
BslFI	GGGAC	1 cut(s)	445
BslI	CCNNNNNNNGG	1 cut(s)	200
BsmFI	GGGAC	1 cut(s)	445
BsnI	GGCC	2 cut(s)	286, 352
Bsp143I	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
BspANI	GGCC	2 cut(s)	286, 352
BspLI	GGNNCC	2 cut(s)	6, 192
BspPI	GGATC	5 cut(s)	141, 185, 198, 364, 448
BspTI	CTTAAG	1 cut(s)	232
BsrDI	GCAATG	1 cut(s)	75
BsrI	ACTGG	1 cut(s)	140
BssECI	CCNNGG	2 cut(s)	21, 129
BssMI	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
BssT1I	CCWWGG	1 cut(s)	21
Bst2UI	CCWGG	3 cut(s)	130, 354, 458
Bst4CI	ACNGT	1 cut(s)	436
BstAFI	CTTAAG	1 cut(s)	232
BstC8I	GCNNGC	1 cut(s)	242
BstDEI	CTNAG	1 cut(s)	9
BstF5I	GGATG	1 cut(s)	17
BstKTI	GATC	7 cut(s)	136, 193, 226, 283, 359, 410, 456
BstMBI	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
BstMWI	GCNNNNNNNGC	1 cut(s)	349
BstNI	CCWGG	3 cut(s)	130, 354, 458
BstNSI	RCATGY	1 cut(s)	248
BstSCI	CCNGG	3 cut(s)	128, 352, 456
BstX2I	RGATCY	4 cut(s)	133, 190, 356, 453
BstYI	RGATCY	4 cut(s)	133, 190, 356, 453
BsuRI	GGCC	2 cut(s)	286, 352
BtsCI	GGATG	1 cut(s)	17
BtsIMutI	CAGTG	1 cut(s)	417
Cac8I	GCNNGC	1 cut(s)	242
CaiI	CAGNNNCTG	1 cut(s)	359
Csp6I	GTAC	1 cut(s)	13
CviAII	CATG	3 cut(s)	150, 245, 292
CviJI	RGCY	4 cut(s)	5, 178, 286, 352
CviKI_1	RGCY	4 cut(s)	5, 178, 286, 352
CviQI	GTAC	1 cut(s)	13
DdeI	CTNAG	1 cut(s)	9
DpnI	GATC	7 cut(s)	135, 192, 225, 282, 358, 409, 455
DpnII	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
EaeI	YGGCCR	1 cut(s)	284
Eco130I	CCWWGG	1 cut(s)	21
Eco32I	GATATC	1 cut(s)	306
EcoRII	CCWGG	3 cut(s)	128, 352, 456
EcoRV	GATATC	1 cut(s)	306
EcoT14I	CCWWGG	1 cut(s)	21
EcoT22I	ATGCAT	1 cut(s)	151
ErhI	CCWWGG	1 cut(s)	21
FaeI	CATG	3 cut(s)	153, 248, 295
FaiI	YATR	7 cut(s)	147, 151, 246, 259, 293, 311, 475
FaqI	GGGAC	1 cut(s)	445
FatI	CATG	3 cut(s)	149, 244, 291
FblI	GTMKAC	1 cut(s)	253
FokI	GGATG	1 cut(s)	4
FspBI	CTAG	2 cut(s)	179, 200
HaeIII	GGCC	2 cut(s)	286, 352
Hin1II	CATG	3 cut(s)	153, 248, 295
HincII	GTYRAC	1 cut(s)	315
HindII	GTYRAC	1 cut(s)	315
Hpy166II	GTNNAC	3 cut(s)	254, 315, 468
Hpy188I	TCNGA	4 cut(s)	46, 109, 298, 376
Hpy188III	TCNNGA	1 cut(s)	8
Hpy8I	GTNNAC	3 cut(s)	254, 315, 468
HpyAV	CCTTC	1 cut(s)	383
HpyCH4III	ACNGT	1 cut(s)	436
HpyCH4V	TGCA	5 cut(s)	149, 173, 244, 275, 331
HpyF10VI	GCNNNNNNNGC	1 cut(s)	349
HpyF3I	CTNAG	1 cut(s)	9
Hsp92II	CATG	3 cut(s)	153, 248, 295
Kzo9I	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
LmnI	GCTCC	1 cut(s)	10
LpnPI	CCDG	9 cut(s)	21, 115, 142, 153, 159, 339, 366, 443, 470
LweI	GCATC	2 cut(s)	26, 227
MaeI	CTAG	2 cut(s)	179, 200
MalI	GATC	7 cut(s)	135, 192, 225, 282, 358, 409, 455
MboI	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
MboII	GAAGA	3 cut(s)	111, 431, 434
MflI	RGATCY	4 cut(s)	133, 190, 356, 453
MluCI	AATT	7 cut(s)	27, 78, 205, 227, 318, 332, 369
MnlI	CCTC	2 cut(s)	259, 348
Mph1103I	ATGCAT	1 cut(s)	151
MroXI	GAANNNNTTC	1 cut(s)	103
MseI	TTAA	4 cut(s)	83, 216, 233, 321
MspCI	CTTAAG	1 cut(s)	232
MspR9I	CCNGG	3 cut(s)	130, 354, 458
MvaI	CCWGG	3 cut(s)	130, 354, 458
MwoI	GCNNNNNNNGC	1 cut(s)	349
NdeII	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
NlaIII	CATG	3 cut(s)	153, 248, 295
NlaIV	GGNNCC	2 cut(s)	6, 192
NsiI	ATGCAT	1 cut(s)	151
NspI	RCATGY	1 cut(s)	248
PdmI	GAANNNNTTC	1 cut(s)	103
PfoI	TCCNGGA	1 cut(s)	456
Psp6I	CCWGG	3 cut(s)	128, 352, 456
PspGI	CCWGG	3 cut(s)	128, 352, 456
PspN4I	GGNNCC	2 cut(s)	6, 192
PstNI	CAGNNNCTG	1 cut(s)	359
PsuI	RGATCY	4 cut(s)	133, 190, 356, 453
RsaI	GTAC	1 cut(s)	14
RsaNI	GTAC	1 cut(s)	13
SaqAI	TTAA	4 cut(s)	83, 216, 233, 321
Sau3AI	GATC	7 cut(s)	133, 190, 223, 280, 356, 407, 453
ScrFI	CCNGG	3 cut(s)	130, 354, 458
SetI	ASST	4 cut(s)	172, 340, 394, 467
SfaNI	GCATC	2 cut(s)	26, 227
SmlI	CTYRAG	1 cut(s)	232
SmoI	CTYRAG	1 cut(s)	232
Sse9I	AATT	7 cut(s)	27, 78, 205, 227, 318, 332, 369
SspMI	CTAG	2 cut(s)	179, 200
StyD4I	CCNGG	3 cut(s)	128, 352, 456
StyI	CCWWGG	1 cut(s)	21
TaaI	ACNGT	1 cut(s)	436
TasI	AATT	7 cut(s)	27, 78, 205, 227, 318, 332, 369
Tru1I	TTAA	4 cut(s)	83, 216, 233, 321
Tru9I	TTAA	4 cut(s)	83, 216, 233, 321
TscAI	CASTG	1 cut(s)	417
TspDTI	ATGAA	1 cut(s)	381
TspRI	CASTG	1 cut(s)	417
Vha464I	CTTAAG	1 cut(s)	232
XapI	RAATTY	3 cut(s)	27, 78, 369
XceI	RCATGY	1 cut(s)	248
XcmI	CCANNNNNNNNNTGG	1 cut(s)	147
XmiI	GTMKAC	1 cut(s)	253
XmnI	GAANNNNTTC	1 cut(s)	103
XspI	CTAG	2 cut(s)	179, 200
Zsp2I	ATGCAT	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.