Rmu_sc0014903.1_g000002

MAP kinase kinase kinase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014903.1
OG0000922
Physical Location & Seq
Reverse (-)
4048 .. 7532
3485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014903.1_g000002.1.cds

Sequence Viewer

Length: 1506 bp
atgtgtatgcttaatgatcttcagggagcaaatatccttgttgataataaaggacgcattaaactagcagattttggggcatccaaacaggcaaccagttcttctgcaaagcctacaaggggtacgccatattggatggctcctgaagttgttcgtgggactggttcttatattctaattcatttcatgcaacatccttttttaactgggaaacaagggaaatctcagtctggtggtcatactgcttccatggaaatgagttcctttcaggggtgtcatgaagttattaaccccatcatggaactggaaggagtggtatccatagagtctgaaacatgtgatgaagatattgatagcacttggagcgaccatagttccgactccaataatccagccgctcacgccaataaacatatcttttcaatattctttagaaagtttaagagaccaacaataactcctagtcatggatctacaaagggcaagttcagctatgcatctatcaagttggccacatgcaacttctctgaggaaaacaagctcggacaagggggctttggatgtgtgtataagggaatcttggagactggacaacaggtagctgtgaaaaggctttcactatcttcaaggcaaggattgttggagtttaataatgaactgagaagtataggtgaactccaacatagaaacgttattcagattttaggatattgcattcatggtgatgagaaaatattaatatacgagttcatgccaaaagtgagtttggactactatttacgagattcatccaaaagcttgctactagattggaggaagcgattcaatataattaaaggacttactcaaggattggtttacttgcacgtatactccagaattagagtaattcacagagatataaaacccagtaatattctacttgatgaaagttttaatcccaaaatttctgattttggtttggcaaagattttgacacatgatagaaagaaagcaaaaactagacgcattgctgggacacgtggttacatggctcctgagtacgcatccttgggaatttttggagtaaaatctgatgtctttagttttggagtggcaatgcttcaaattttaagtggtagaagtagaagatattctgacttctccaaaactcttgcctgggatctaccagtctatgcatgggagttgtggaaaaaaggtgcagggctagaactaatggatccaatgctaggcaattcttgtattaacaaagatcaattcttaagatgcttgcatgttggtctactatgtgtggaggcaaatgcagatgatcggccaaccatgtcagatgtgatatctatgttgacaattaaaagtgtgcaattacctctgccaaaaaggccaggatctgttgatgaaatttctgattttgatggggaaggtgtgatgggagtgagatcagtgagcgaagaagatgtggggacagtctttggaatgatggagatcctggaaaggtggacattatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04010 ko04016 ko04722 ko04912 ko05166 map04010 map04016 map04722 map04912 map05166
Pfam Domains
Protein Families
Pkinase

Protein Analysis

501

Amino Acids

55.98

Weight (kDa)

8.56

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 398
AccI GTMKAC 2 cut(s) 870, 1282
AciI CCGC 1 cut(s) 396
AclI AACGTT 1 cut(s) 690
AclWI GGATC 6 cut(s) 478, 1170, 1214, 1227, 1393, 1477
AcoI YGGCCR 2 cut(s) 510, 1313
AcsI RAATTY 4 cut(s) 945, 1056, 1107, 1398
AcuI CTGAAG 2 cut(s) 5, 165
AcvI CACGTG 1 cut(s) 1022
AfaI GTAC 2 cut(s) 124, 1043
AfiI CCNNNNNNNGG 5 cut(s) 119, 270, 298, 467, 1229
AflII CTTAAG 1 cut(s) 1261
AflIII ACRYGT 2 cut(s) 335, 1019
AgsI TTSAA 4 cut(s) 423, 627, 826, 1106
AjnI CCWGG 3 cut(s) 1157, 1381, 1485
AluBI AGCT 4 cut(s) 492, 541, 602, 798
AluI AGCT 4 cut(s) 492, 541, 602, 798
Alw26I GTCTC 2 cut(s) 439, 578
AlwI GGATC 6 cut(s) 478, 1170, 1214, 1227, 1393, 1477
AlwNI CAGNNNCTG 1 cut(s) 1388
AoxI GGCC 3 cut(s) 510, 1313, 1379
ApoI RAATTY 4 cut(s) 945, 1056, 1107, 1398
AseI ATTAAT 1 cut(s) 737
Asp700I GAANNNNTTC 3 cut(s) 150, 821, 1132
AsuHPI GGTGA 2 cut(s) 683, 734
BalI TGGCCA 1 cut(s) 512
BamHI GGATCC 1 cut(s) 1219
BbrPI CACGTG 1 cut(s) 1022
BccI CCATC 5 cut(s) 130, 302, 1406, 1420, 1471
BciT130I CCWGG 3 cut(s) 1159, 1383, 1487
BciVI GTATCC 1 cut(s) 328
BcoDI GTCTC 2 cut(s) 439, 578
BfaI CTAG 6 cut(s) 65, 462, 806, 1002, 1208, 1229
BfrI CTTAAG 1 cut(s) 1261
BfuI GTATCC 1 cut(s) 328
BglI GCCNNNNNGGC 1 cut(s) 1378
BisI GCNGC 1 cut(s) 396
BlsI GCNGC 1 cut(s) 397
Bme1390I CCNGG 3 cut(s) 1159, 1383, 1487
BmiI GGNNCC 3 cut(s) 141, 1035, 1221
BmrFI CCNGG 3 cut(s) 1159, 1383, 1487
BmrI ACTGGG 2 cut(s) 216, 903
BmsI GCATC 4 cut(s) 89, 506, 1055, 1256
BmuI ACTGGG 2 cut(s) 216, 903
BpmI CTGGAG 1 cut(s) 859
BpuEI CTTGAG 1 cut(s) 831
BsaAI YACGTR 2 cut(s) 868, 1022
BsaBI GATNNNNATC 1 cut(s) 1481
BsaI GGTCTC 1 cut(s) 439
BsaJI CCNNGG 3 cut(s) 249, 1050, 1158
BsaXI ACNNNNNCTCC 4 cut(s) 442, 472, 857, 887
Bsc4I CCNNNNNNNGG 5 cut(s) 119, 270, 298, 467, 1229
Bse1I ACTGG 7 cut(s) 96, 166, 211, 309, 592, 909, 1169
Bse3DI GCAATG 2 cut(s) 1008, 1104
Bse8I GATNNNNATC 1 cut(s) 1481
BseBI CCWGG 3 cut(s) 1159, 1383, 1487
BseDI CCNNGG 3 cut(s) 249, 1050, 1158
BseGI GGATG 6 cut(s) 80, 141, 193, 566, 788, 1046
BseJI GATNNNNATC 1 cut(s) 1481
BseLI CCNNNNNNNGG 5 cut(s) 119, 270, 298, 467, 1229
BseMI GCAATG 2 cut(s) 1008, 1104
BseMII CTCAG 4 cut(s) 239, 519, 650, 1029
BseNI ACTGG 7 cut(s) 96, 166, 211, 309, 592, 909, 1169
BseYI CCCAGC 1 cut(s) 1013
BsgI GTGCAG 1 cut(s) 1221
BshFI GGCC 3 cut(s) 512, 1315, 1381
BslFI GGGAC 3 cut(s) 172, 1030, 1474
BslI CCNNNNNNNGG 5 cut(s) 119, 270, 298, 467, 1229
BsmAI GTCTC 2 cut(s) 439, 578
BsmFI GGGAC 3 cut(s) 172, 1030, 1474
BsmI GAATGC 1 cut(s) 714
BsnI GGCC 3 cut(s) 512, 1315, 1381
Bso31I GGTCTC 1 cut(s) 439
Bsp143I GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
Bsp19I CCATGG 1 cut(s) 249
BspACI CCGC 1 cut(s) 396
BspANI GGCC 3 cut(s) 512, 1315, 1381
BspCNI CTCAG 4 cut(s) 238, 520, 651, 1030
BspHI TCATGA 1 cut(s) 277
BspLI GGNNCC 3 cut(s) 141, 1035, 1221
BspPI GGATC 6 cut(s) 478, 1170, 1214, 1227, 1393, 1477
BspTI CTTAAG 1 cut(s) 1261
BspTNI GGTCTC 1 cut(s) 439
BsrBI CCGCTC 1 cut(s) 398
BsrDI GCAATG 2 cut(s) 1008, 1104
BsrI ACTGG 7 cut(s) 96, 166, 211, 309, 592, 909, 1169
BssECI CCNNGG 3 cut(s) 249, 1050, 1158
BssMI GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
BssNAI GTATAC 1 cut(s) 871
BssT1I CCWWGG 2 cut(s) 249, 1050
Bst1107I GTATAC 1 cut(s) 871
Bst2UI CCWGG 3 cut(s) 1159, 1383, 1487
Bst4CI ACNGT 1 cut(s) 1465
BstAFI CTTAAG 1 cut(s) 1261
BstBAI YACGTR 2 cut(s) 868, 1022
BstC8I GCNNGC 2 cut(s) 800, 1271
BstDEI CTNAG 4 cut(s) 225, 528, 659, 1038
BstDSI CCRYGG 1 cut(s) 249
BstF5I GGATG 6 cut(s) 80, 141, 193, 566, 788, 1046
BstKTI GATC 9 cut(s) 19, 473, 1165, 1222, 1255, 1312, 1388, 1439, 1485
BstMAI GTCTC 2 cut(s) 439, 578
BstMBI GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
BstMWI GCNNNNNNNGC 4 cut(s) 363, 401, 489, 1378
BstNI CCWGG 3 cut(s) 1159, 1383, 1487
BstNSI RCATGY 3 cut(s) 339, 519, 1277
BstSCI CCNGG 3 cut(s) 1157, 1381, 1485
BstX2I RGATCY 5 cut(s) 470, 1162, 1219, 1385, 1482
BstYI RGATCY 5 cut(s) 470, 1162, 1219, 1385, 1482
BstZ17I GTATAC 1 cut(s) 871
BsuI GTATCC 1 cut(s) 328
BsuRI GGCC 3 cut(s) 512, 1315, 1381
BtgI CCRYGG 1 cut(s) 249
BtsCI GGATG 6 cut(s) 80, 141, 193, 566, 788, 1046
BtsIMutI CAGTG 1 cut(s) 1446
Cac8I GCNNGC 2 cut(s) 800, 1271
CaiI CAGNNNCTG 1 cut(s) 1388
CciI TCATGA 1 cut(s) 277
CseI GACGC 2 cut(s) 63, 1014
Csp6I GTAC 2 cut(s) 123, 1042
CviQI GTAC 2 cut(s) 123, 1042
DdeI CTNAG 4 cut(s) 225, 528, 659, 1038
DpnI GATC 9 cut(s) 18, 472, 1164, 1221, 1254, 1311, 1387, 1438, 1484
DpnII GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
EaeI YGGCCR 2 cut(s) 510, 1313
Eco130I CCWWGG 2 cut(s) 249, 1050
Eco31I GGTCTC 1 cut(s) 439
Eco32I GATATC 1 cut(s) 1335
Eco57I CTGAAG 2 cut(s) 5, 165
Eco72I CACGTG 1 cut(s) 1022
EcoRII CCWGG 3 cut(s) 1157, 1381, 1485
EcoRV GATATC 1 cut(s) 1335
EcoT14I CCWWGG 2 cut(s) 249, 1050
EcoT22I ATGCAT 2 cut(s) 499, 1180
ErhI CCWWGG 2 cut(s) 249, 1050
FalI AAGNNNNNCTT 2 cut(s) 563, 595
FaqI GGGAC 3 cut(s) 172, 1030, 1474
FblI GTMKAC 2 cut(s) 870, 1282
Fnu4HI GCNGC 1 cut(s) 396
FokI GGATG 6 cut(s) 67, 148, 180, 573, 775, 1033
Fsp4HI GCNGC 1 cut(s) 396
FspBI CTAG 6 cut(s) 65, 462, 806, 1002, 1208, 1229
GluI GCNGC 1 cut(s) 396
GsaI CCCAGC 1 cut(s) 1017
GsuI CTGGAG 1 cut(s) 859
HaeIII GGCC 3 cut(s) 512, 1315, 1381
HgaI GACGC 2 cut(s) 63, 1014
HincII GTYRAC 1 cut(s) 1344
HindII GTYRAC 1 cut(s) 1344
HindIII AAGCTT 1 cut(s) 796
HinfI GANTC 5 cut(s) 326, 380, 576, 785, 822
HphI GGTGA 2 cut(s) 683, 734
Hpy166II GTNNAC 6 cut(s) 674, 859, 871, 1283, 1344, 1497
Hpy188III TCNNGA 4 cut(s) 143, 278, 876, 1037
Hpy8I GTNNAC 6 cut(s) 674, 859, 871, 1283, 1344, 1497
HpyAV CCTTC 2 cut(s) 302, 1412
HpyCH4III ACNGT 1 cut(s) 1465
HpyCH4IV ACGT 3 cut(s) 690, 867, 1021
HpyF10VI GCNNNNNNNGC 4 cut(s) 363, 401, 489, 1378
HpyF3I CTNAG 4 cut(s) 225, 528, 659, 1038
HpySE526I ACGT 3 cut(s) 690, 867, 1021
Kzo9I GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
LmnI GCTCC 4 cut(s) 26, 145, 363, 1039
LweI GCATC 4 cut(s) 89, 506, 1055, 1256
MaeI CTAG 6 cut(s) 65, 462, 806, 1002, 1208, 1229
MaeII ACGT 3 cut(s) 690, 867, 1021
MaeIII GTNAC 1 cut(s) 1025
MalI GATC 9 cut(s) 18, 472, 1164, 1221, 1254, 1311, 1387, 1438, 1484
MbiI CCGCTC 1 cut(s) 398
MboI GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
MboII GAAGA 7 cut(s) 11, 93, 356, 615, 1140, 1460, 1463
MflI RGATCY 5 cut(s) 470, 1162, 1219, 1385, 1482
MlsI TGGCCA 1 cut(s) 512
MluNI TGGCCA 1 cut(s) 512
MlyI GAGTC 2 cut(s) 335, 374
MmeI TCCRAC 3 cut(s) 402, 621, 703
MnlI CCTC 4 cut(s) 523, 807, 1288, 1377
Mox20I TGGCCA 1 cut(s) 512
Mph1103I ATGCAT 2 cut(s) 499, 1180
MroXI GAANNNNTTC 3 cut(s) 150, 821, 1132
MscI TGGCCA 1 cut(s) 512
MslI CAYNNNNRTG 2 cut(s) 254, 723
Msp20I TGGCCA 1 cut(s) 512
MspCI CTTAAG 1 cut(s) 1261
MspR9I CCNGG 3 cut(s) 1159, 1383, 1487
Mva1269I GAATGC 1 cut(s) 714
MvaI CCWGG 3 cut(s) 1159, 1383, 1487
MwoI GCNNNNNNNGC 4 cut(s) 363, 401, 489, 1378
NcoI CCATGG 1 cut(s) 249
NdeII GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
NlaIV GGNNCC 3 cut(s) 141, 1035, 1221
NsiI ATGCAT 2 cut(s) 499, 1180
NspI RCATGY 3 cut(s) 339, 519, 1277
PagI TCATGA 1 cut(s) 277
PciI ACATGT 1 cut(s) 335
PctI GAATGC 1 cut(s) 714
PdmI GAANNNNTTC 3 cut(s) 150, 821, 1132
PfeI GAWTC 3 cut(s) 576, 785, 822
PfoI TCCNGGA 1 cut(s) 1485
PkrI GCNGC 1 cut(s) 397
PleI GAGTC 2 cut(s) 334, 374
PmaCI CACGTG 1 cut(s) 1022
PmlI CACGTG 1 cut(s) 1022
PpsI GAGTC 2 cut(s) 334, 374
Ppu21I YACGTR 2 cut(s) 868, 1022
PscI ACATGT 1 cut(s) 335
PshBI ATTAAT 1 cut(s) 737
Psp1406I AACGTT 1 cut(s) 690
Psp6I CCWGG 3 cut(s) 1157, 1381, 1485
PspCI CACGTG 1 cut(s) 1022
PspFI CCCAGC 1 cut(s) 1013
PspGI CCWGG 3 cut(s) 1157, 1381, 1485
PspN4I GGNNCC 3 cut(s) 141, 1035, 1221
PstNI CAGNNNCTG 1 cut(s) 1388
PsuI RGATCY 5 cut(s) 470, 1162, 1219, 1385, 1482
RsaI GTAC 2 cut(s) 124, 1043
RsaNI GTAC 2 cut(s) 123, 1042
RseI CAYNNNNRTG 2 cut(s) 254, 723
SatI GCNGC 1 cut(s) 396
Sau3AI GATC 9 cut(s) 16, 470, 1162, 1219, 1252, 1309, 1385, 1436, 1482
SchI GAGTC 2 cut(s) 335, 374
ScrFI CCNGG 3 cut(s) 1159, 1383, 1487
SfaNI GCATC 4 cut(s) 89, 506, 1055, 1256
SmiMI CAYNNNNRTG 2 cut(s) 254, 723
SmlI CTYRAG 2 cut(s) 846, 1261
SmoI CTYRAG 2 cut(s) 846, 1261
SsiI CCGC 1 cut(s) 396
SspI AATATT 3 cut(s) 426, 735, 916
SspMI CTAG 6 cut(s) 65, 462, 806, 1002, 1208, 1229
StyD4I CCNGG 3 cut(s) 1157, 1381, 1485
StyI CCWWGG 2 cut(s) 249, 1050
TaaI ACNGT 1 cut(s) 1465
TaiI ACGT 3 cut(s) 693, 870, 1024
TauI GCSGC 1 cut(s) 398
TfiI GAWTC 3 cut(s) 576, 785, 822
TscAI CASTG 1 cut(s) 1446
TspRI CASTG 1 cut(s) 1446
Vha464I CTTAAG 1 cut(s) 1261
VspI ATTAAT 1 cut(s) 737
XapI RAATTY 4 cut(s) 945, 1056, 1107, 1398
XceI RCATGY 3 cut(s) 339, 519, 1277
XcmI CCANNNNNNNNNTGG 2 cut(s) 301, 1176
XmiI GTMKAC 2 cut(s) 870, 1282
XmnI GAANNNNTTC 3 cut(s) 150, 821, 1132
XspI CTAG 6 cut(s) 65, 462, 806, 1002, 1208, 1229
Zsp2I ATGCAT 2 cut(s) 499, 1180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.