Rmu_co8476593.1_g000001

MAP kinase kinase kinase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8476593.1
Physical Location & Seq
Reverse (-)
2 .. 1164
1163 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8476593.1_g000001.1.cds

Sequence Viewer

Length: 392 bp
atgtcttcaatccccagagacgaagcagcctcgattcaatggcagaagggcgatttgatcggttccggggcctttggccgtgtttacatgggcatgaataccgaatccggagagcttattgctgcaaaagaggctcatacgaaggtgcttcaagatgaagtgaggcttttagaaaacctgtcgcatccgaaaattattagatgtttaggaaccgagagggaggatgaaaccttaactatgctgttggaatatgtacctggaggatccatacaagcactattggagaaatttggatctttctctgttcctgtaataaaaagattcaccaagcagttgttgctggcactagaatatttacacaaaaaaggaatcatacatggggacattaaggt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.57

Weight (kDa)

6.42

Isoelectric Point (pI)

30.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 107
AclWI GGATC 3 cut(s) 258, 271, 301
AcoI YGGCCR 1 cut(s) 76
AcsI RAATTY 1 cut(s) 287
AfaI GTAC 1 cut(s) 255
AgsI TTSAA 3 cut(s) 9, 38, 152
AjnI CCWGG 1 cut(s) 256
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw26I GTCTC 1 cut(s) 12
AlwI GGATC 3 cut(s) 258, 271, 301
Aor13HI TCCGGA 1 cut(s) 107
AoxI GGCC 2 cut(s) 69, 76
ApeKI GCWGC 2 cut(s) 26, 122
ApoI RAATTY 1 cut(s) 287
AspS9I GGNCC 1 cut(s) 69
AsuC2I CCSGG 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 316
BamHI GGATCC 1 cut(s) 263
BbvI GCAGC 2 cut(s) 38, 109
BceAI ACGGC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 258
BcnI CCSGG 1 cut(s) 67
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 1 cut(s) 347
BisI GCNGC 2 cut(s) 27, 123
BlsI GCNGC 2 cut(s) 28, 124
Bme1390I CCNGG 2 cut(s) 67, 258
BmgT120I GGNCC 1 cut(s) 69
BmiI GGNNCC 4 cut(s) 64, 70, 211, 265
BmrFI CCNGG 2 cut(s) 67, 258
BmsI GCATC 1 cut(s) 193
BpmI CTGGAG 1 cut(s) 279
BpuMI CCSGG 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 66
BsaWI WCCGGW 1 cut(s) 107
BseAI TCCGGA 1 cut(s) 107
BseBI CCWGG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 66
BseGI GGATG 2 cut(s) 184, 229
BseXI GCAGC 2 cut(s) 38, 109
BshFI GGCC 2 cut(s) 71, 78
BsiSI CCGG 2 cut(s) 66, 108
BsmAI GTCTC 1 cut(s) 12
BsmBI CGTCTC 1 cut(s) 12
BsnI GGCC 2 cut(s) 71, 78
Bsp13I TCCGGA 1 cut(s) 107
Bsp143I GATC 3 cut(s) 57, 263, 293
BspANI GGCC 2 cut(s) 71, 78
BspEI TCCGGA 1 cut(s) 107
BspLI GGNNCC 4 cut(s) 64, 70, 211, 265
BspPI GGATC 3 cut(s) 258, 271, 301
BssECI CCNNGG 1 cut(s) 66
BssMI GATC 3 cut(s) 57, 263, 293
Bst2UI CCWGG 1 cut(s) 258
BstAPI GCANNNNNTGC 1 cut(s) 337
BstC8I GCNNGC 1 cut(s) 342
BstF5I GGATG 2 cut(s) 184, 229
BstKTI GATC 3 cut(s) 60, 266, 296
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 3 cut(s) 57, 263, 293
BstMWI GCNNNNNNNGC 2 cut(s) 131, 337
BstNI CCWGG 1 cut(s) 258
BstSCI CCNGG 2 cut(s) 65, 256
BstV1I GCAGC 2 cut(s) 38, 109
BstX2I RGATCY 2 cut(s) 263, 293
BstYI RGATCY 2 cut(s) 263, 293
BsuRI GGCC 2 cut(s) 71, 78
BtsCI GGATG 2 cut(s) 184, 229
Cac8I GCNNGC 1 cut(s) 342
Cfr13I GGNCC 1 cut(s) 69
Csp6I GTAC 1 cut(s) 254
CviAII CATG 3 cut(s) 88, 94, 377
CviJI RGCY 6 cut(s) 29, 71, 78, 115, 134, 166
CviKI_1 RGCY 6 cut(s) 29, 71, 78, 115, 134, 166
CviQI GTAC 1 cut(s) 254
DpnI GATC 3 cut(s) 59, 265, 295
DpnII GATC 3 cut(s) 57, 263, 293
EaeI YGGCCR 1 cut(s) 76
EcoO109I RGGNCCY 1 cut(s) 69
EcoRII CCWGG 1 cut(s) 256
Esp3I CGTCTC 1 cut(s) 12
FaeI CATG 3 cut(s) 91, 97, 380
FaiI YATR 8 cut(s) 89, 95, 138, 239, 252, 269, 374, 378
FalI AAGNNNNNCTT 2 cut(s) 150, 182
FatI CATG 3 cut(s) 87, 93, 376
Fnu4HI GCNGC 2 cut(s) 27, 123
FokI GGATG 2 cut(s) 171, 236
Fsp4HI GCNGC 2 cut(s) 27, 123
FspBI CTAG 1 cut(s) 347
GluI GCNGC 2 cut(s) 27, 123
GsuI CTGGAG 1 cut(s) 279
HaeIII GGCC 2 cut(s) 71, 78
HapII CCGG 2 cut(s) 66, 108
Hin1II CATG 3 cut(s) 91, 97, 380
HinfI GANTC 4 cut(s) 34, 104, 321, 369
HpaII CCGG 2 cut(s) 66, 108
HphI GGTGA 1 cut(s) 316
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 108, 152
Hpy8I GTNNAC 1 cut(s) 85
HpyAV CCTTC 2 cut(s) 40, 136
HpyCH4V TGCA 1 cut(s) 125
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 337
Hsp92II CATG 3 cut(s) 91, 97, 380
Kpn2I TCCGGA 1 cut(s) 107
Kzo9I GATC 3 cut(s) 57, 263, 293
LpnPI CCDG 8 cut(s) 28, 79, 121, 191, 243, 270, 321, 326
Lsp1109I GCAGC 2 cut(s) 38, 109
LweI GCATC 1 cut(s) 193
MaeI CTAG 1 cut(s) 347
MalI GATC 3 cut(s) 59, 265, 295
MboI GATC 3 cut(s) 57, 263, 293
MflI RGATCY 2 cut(s) 263, 293
MluCI AATT 2 cut(s) 192, 287
MmeI TCCRAC 1 cut(s) 225
MnlI CCTC 6 cut(s) 40, 124, 156, 210, 214, 254
MroI TCCGGA 1 cut(s) 107
MseI TTAA 2 cut(s) 233, 387
MslI CAYNNNNRTG 1 cut(s) 92
MspI CCGG 2 cut(s) 66, 108
MspR9I CCNGG 2 cut(s) 67, 258
MvaI CCWGG 1 cut(s) 258
MwoI GCNNNNNNNGC 2 cut(s) 131, 337
NciI CCSGG 1 cut(s) 67
NdeII GATC 3 cut(s) 57, 263, 293
NlaIII CATG 3 cut(s) 91, 97, 380
NlaIV GGNNCC 4 cut(s) 64, 70, 211, 265
PfeI GAWTC 4 cut(s) 34, 104, 321, 369
PkrI GCNGC 2 cut(s) 28, 124
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
PspN4I GGNNCC 4 cut(s) 64, 70, 211, 265
PspPI GGNCC 1 cut(s) 69
PsuI RGATCY 2 cut(s) 263, 293
RsaI GTAC 1 cut(s) 255
RsaNI GTAC 1 cut(s) 254
RseI CAYNNNNRTG 1 cut(s) 92
SaqAI TTAA 2 cut(s) 233, 387
SatI GCNGC 2 cut(s) 27, 123
Sau3AI GATC 3 cut(s) 57, 263, 293
Sau96I GGNCC 1 cut(s) 69
ScrFI CCNGG 2 cut(s) 67, 258
SetI ASST 5 cut(s) 117, 147, 180, 233, 259
SfaNI GCATC 1 cut(s) 193
SmiMI CAYNNNNRTG 1 cut(s) 92
Sse9I AATT 2 cut(s) 192, 287
SspI AATATT 1 cut(s) 353
SspMI CTAG 1 cut(s) 347
StyD4I CCNGG 2 cut(s) 65, 256
TaqI TCGA 1 cut(s) 32
TasI AATT 2 cut(s) 192, 287
TfiI GAWTC 4 cut(s) 34, 104, 321, 369
Tru1I TTAA 2 cut(s) 233, 387
Tru9I TTAA 2 cut(s) 233, 387
TseI GCWGC 2 cut(s) 26, 122
TspDTI ATGAA 3 cut(s) 110, 171, 240
XapI RAATTY 1 cut(s) 287
XspI CTAG 1 cut(s) 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.