Rmu_co8246953.1_g000001

Reversible hydration of carbon dioxide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8246953.1
OG0000548
Physical Location & Seq
Reverse (-)
135 .. 657
523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8246953.1_g000001.1.cds

Sequence Viewer

Length: 309 bp
atggaacatccagaagatggcagtgttcccttcgacttcatagatgactgggttaaaattgcccaggatgccaaggataaagttaaagcagagggaggaggacatgaggcttgtgctagggaagctgtaaatgtctctctggaaaacctgctaacttatccttacgttcataaggaggtatcggaaagaaaaatagcacttagaggtggttactatgacttcgtcaatggagttttcgagctctgggagaaacacgaatctcacatttcaccccccatgatcattccgcctccacaattaaggatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00910 map00910
Pfam Domains
Protein Families
Pro_CA

Protein Analysis

102

Amino Acids

11.62

Weight (kDa)

5.1

Isoelectric Point (pI)

50.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000548)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G01500 AT3G01500 AT3G01500 AT3G01500 AT5G14740 AT5G14740 AT5G14740 AT5G14740 AT5G14740 AT5G14740 AT5G14740 AT5G14740 AT5G14740
fragaria_vesca FvH4_2g14190 FvH4_3g35690 FvH4_3g35690 FvH4_6g50780 FvH4_6g50780 FvH4_6g50780 FvH4_6g50780
malus_domestica MD09G1032400.v1.1 MD10G1022000.v1.1 MD10G1022200.v1.1 MD10G1022400.v1.1 MD17G1034000.v1.1
prunus_persica Prupe.3G285600_v2.0.a1 Prupe.3G285600_v2.0.a1 Prupe.3G285600_v2.0.a1 Prupe.3G285600_v2.0.a1 Prupe.3G285600_v2.0.a1 Prupe.3G285600_v2.0.a1 Prupe.6G080400_v2.0.a1 Prupe.8G025400_v2.0.a1
pyrus_communis pycom10g01540 pycom111g02580 pycom17g03140
rosa_chinensis RchiOBHm_Chr2g0172091 RchiOBHm_Chr2g0172171 RchiOBHm_Chr5g0063841 RchiOBHm_Chr5g0063851 RchiOBHm_Chr6g0276331
rosa_laevigata RLG00000013403 RLG00000022084 RLG00000022089 RLG00000035683 RLG00000035684
rosa_multiflora Rmu_co8246953.1_g000001 Rmu_sc0002765.1_g000009 Rmu_sc0002765.1_g000011 Rmu_sc0003665.1_g000009 Rmu_ssc0000252.1_g000041 Rmu_ssc0000252.1_g000047
rosa_roxburghii Rroxscaffold_1G00016930 Rroxscaffold_2G00080110 Rroxscaffold_7G00192380
rosa_rugosa Rorug02G0556500 Rorug02G0556600 Rorug02G0556700 Rorug02G0556800 Rorug05G0360800 Rorug06G0100000 Rorug06G0100000
rosa_samantha Rh2AG632300 Rh2BG642200 Rh2BG645900 Rh2CG612500 Rh2DG653300 Rh2DG660500 Rh5AG418900 Rh5AG419000 Rh5BG435100 Rh5BG435200 Rh5CG458100 Rh5CG458200 Rh5DG447900 Rh5DG448000 Rh6AG211200 Rh6CG217900 Rh6DG208000
rosa_wichuraiana Rw2G052340 Rw5G039370 Rw5G039380 Rw6G018450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 156
AccB7I CCANNNNNTGG 1 cut(s) 17
AciI CCGC 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 17
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 2 cut(s) 125, 241
AluI AGCT 2 cut(s) 125, 241
Alw21I GWGCWC 1 cut(s) 243
Alw26I GTCTC 1 cut(s) 139
AsuHPI GGTGA 1 cut(s) 261
BanII GRGCYC 1 cut(s) 243
Bbv12I GWGCWC 1 cut(s) 243
BccI CCATC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 65
BclI TGATCA 1 cut(s) 279
BcoDI GTCTC 1 cut(s) 139
BfaI CTAG 1 cut(s) 117
BfuAI ACCTGC 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BmrI ACTGGG 1 cut(s) 58
BmsI GCATC 1 cut(s) 58
BmuI ACTGGG 1 cut(s) 58
BsaJI CCNNGG 2 cut(s) 63, 72
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 65
BseDI CCNNGG 2 cut(s) 63, 72
BseGI GGATG 3 cut(s) 7, 73, 309
BseLI CCNNNNNNNGG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 53
BseRI GAGGAG 1 cut(s) 111
BsiHKAI GWGCWC 1 cut(s) 243
BslI CCNNNNNNNGG 1 cut(s) 17
BsmAI GTCTC 1 cut(s) 139
Bsp1286I GDGCHC 1 cut(s) 243
Bsp143I GATC 1 cut(s) 279
BspACI CCGC 1 cut(s) 287
BspMI ACCTGC 1 cut(s) 156
BsrI ACTGG 1 cut(s) 53
BssECI CCNNGG 2 cut(s) 63, 72
BssMI GATC 1 cut(s) 279
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 200
BstF5I GGATG 3 cut(s) 7, 73, 309
BstKTI GATC 1 cut(s) 282
BstMAI GTCTC 1 cut(s) 139
BstMBI GATC 1 cut(s) 279
BstMWI GCNNNNNNNGC 2 cut(s) 68, 122
BstNI CCWGG 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 63
BtsCI GGATG 3 cut(s) 7, 73, 309
BtsI GCAGTG 1 cut(s) 28
BtsIMutI CAGTG 1 cut(s) 28
BveI ACCTGC 1 cut(s) 156
CviAII CATG 2 cut(s) 104, 277
CviJI RGCY 3 cut(s) 110, 125, 241
CviKI_1 RGCY 3 cut(s) 110, 125, 241
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
EciI GGCGGA 1 cut(s) 276
Ecl136II GAGCTC 1 cut(s) 241
Eco130I CCWWGG 1 cut(s) 72
Eco24I GRGCYC 1 cut(s) 243
Eco53kI GAGCTC 1 cut(s) 241
EcoICRI GAGCTC 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 63
EcoT14I CCWWGG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 2 cut(s) 107, 280
FaiI YATR 5 cut(s) 41, 105, 171, 216, 278
FatI CATG 2 cut(s) 103, 276
FbaI TGATCA 1 cut(s) 279
FokI GGATG 1 cut(s) 80
FriOI GRGCYC 1 cut(s) 243
FspBI CTAG 1 cut(s) 117
Hin1II CATG 2 cut(s) 107, 280
HinfI GANTC 1 cut(s) 257
HphI GGTGA 1 cut(s) 261
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 2 cut(s) 11, 140
HpyAV CCTTC 1 cut(s) 40
HpyCH4IV ACGT 1 cut(s) 165
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 122
HpyF3I CTNAG 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 2 cut(s) 107, 280
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 1 cut(s) 279
LpnPI CCDG 7 cut(s) 24, 34, 50, 77, 125, 161, 229
LweI GCATC 1 cut(s) 58
MaeI CTAG 1 cut(s) 117
MaeII ACGT 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 209
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MboII GAAGA 1 cut(s) 26
MhlI GDGCHC 1 cut(s) 243
MluCI AATT 2 cut(s) 57, 296
MnlI CCTC 7 cut(s) 85, 89, 92, 100, 169, 197, 300
MseI TTAA 3 cut(s) 54, 84, 299
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
MwoI GCNNNNNNNGC 2 cut(s) 68, 122
NdeII GATC 1 cut(s) 279
NlaIII CATG 2 cut(s) 107, 280
PfeI GAWTC 1 cut(s) 257
PflFI GACNNNGTC 1 cut(s) 221
PflMI CCANNNNNTGG 1 cut(s) 17
Psp124BI GAGCTC 1 cut(s) 243
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PsyI GACNNNGTC 1 cut(s) 221
SacI GAGCTC 1 cut(s) 243
SaqAI TTAA 3 cut(s) 54, 84, 299
Sau3AI GATC 1 cut(s) 279
ScrFI CCNGG 1 cut(s) 65
SduI GDGCHC 1 cut(s) 243
SetI ASST 6 cut(s) 127, 150, 168, 180, 208, 243
SfaNI GCATC 1 cut(s) 58
Sse9I AATT 2 cut(s) 57, 296
SsiI CCGC 1 cut(s) 287
SspMI CTAG 1 cut(s) 117
SstI GAGCTC 1 cut(s) 243
StyD4I CCNGG 1 cut(s) 63
StyI CCWWGG 1 cut(s) 72
TaiI ACGT 1 cut(s) 168
TaqI TCGA 2 cut(s) 33, 237
TasI AATT 2 cut(s) 57, 296
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 3 cut(s) 54, 84, 299
Tru9I TTAA 3 cut(s) 54, 84, 299
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 28, 158
TspRI CASTG 1 cut(s) 28
Tth111I GACNNNGTC 1 cut(s) 221
Van91I CCANNNNNTGG 1 cut(s) 17
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.