Rmu_co8419409.1_g000001

zinc finger CCCH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8419409.1
OG0000488
Physical Location & Seq
Reverse (-)
455 .. 1348
894 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8419409.1_g000001.1.cds

Sequence Viewer

Length: 492 bp
atggcttttcttccttggcaaaattccaaggccataattgtgcttctggagagaagtagcaatctttattctcctgccaaagatgaaacagttagggtttgggactgcaatacagtcaaggcatggaatattgagtccaatgctgaatttaccctagctggacctattggtaaagtccatgccatggaagttgggaatgatatggaggcatgcaacattgaaaaaatctacactcacactgaagaacatggtcttcttgctctctctggaatgtatgatgttaaagataaaccattcctactttgctcatcaaaagacaattctgcctgcatatatgatttgccatcctttgataagaagggaagattatttgcaaaacgagaagttcgggctattcaagtgggccttggaggattattcttcattggggatgaaactgctggactttccgtgtggaagtggttggaacctgcagtcaaacaagagtcgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04120 map03040 map04120
Pfam Domains
Protein Families
WD40 zf-CCCH

Protein Analysis

163

Amino Acids

18.22

Weight (kDa)

5.41

Isoelectric Point (pI)

51.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000488)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G25440 AT4G25440 AT4G25440 AT5G51980 AT5G51980
fragaria_vesca FvH4_2g11580 FvH4_3g29280 FvH4_4g05980 FvH4_7g28880 FvH4_7g28880
malus_domestica MD01G1195600.v1.1 MD02G1195200.v1.1 MD07G1262400.v1.1
prunus_persica Prupe.2G102200_v2.0.a1 Prupe.2G102200_v2.0.a1 Prupe.2G120800_v2.0.a1 Prupe.2G120800_v2.0.a1 Prupe.2G153300_v2.0.a1 Prupe.2G153300_v2.0.a1 Prupe.2G153400_v2.0.a1 Prupe.2G153400_v2.0.a1 Prupe.2G288900_v2.0.a1
pyrus_communis pycom01g20620 pycom02g15900 pycom07g24140
rosa_chinensis RchiOBHm_Chr1g0376561 RchiOBHm_Chr3g0483051 RchiOBHm_Chr3g0483061 RchiOBHm_Chr3g0483601 RchiOBHm_Chr3g0483611 RchiOBHm_Chr4g0402321 RchiOBHm_Chr6g0270771
rosa_laevigata RLG00000009464 RLG00000009486 RLG00000013770 RLG00000023264 RLG00000023325 RLG00000026601 RLG00000035049
rosa_multiflora Rmu_co8110388.1_g000001 Rmu_co8419409.1_g000001 Rmu_sc0000555.1_g000012 Rmu_sc0000642.1_g000020 Rmu_sc0001308.1_g000010 Rmu_sc0002963.1_g000021 Rmu_sc0004788.1_g000012 Rmu_sc0005594.1_g000015 Rmu_sc0022770.1_g000001
rosa_roxburghii Rroxscaffold_4G00282000 Rroxscaffold_5G00341940 Rroxscaffold_5G00341950 Rroxscaffold_6G00398950 Rroxscaffold_7G00197610
rosa_rugosa Rorug01G0396500 Rorug03G0207400 Rorug03G0346000 Rorug04G0166800 Rorug06G0056400 Rorug06G0056500
rosa_samantha Rh1AG412700 Rh1BG372400 Rh1BG372600 Rh1CG386200 Rh1CG386500 Rh1DG403300 Rh1DG403500 Rh3AG255500 Rh3AG255600 Rh3BG292600 Rh3CG290200 Rh3DG278800 Rh3DG286100 Rh4AG075500 Rh4AG111600 Rh4BG071900 Rh4BG072100 Rh4BG231300 Rh4CG080200 Rh4CG080300 Rh4DG069300 Rh4DG069500 Rh6AG175700 Rh6BG178900 Rh6CG175200 Rh6DG167500
rosa_wichuraiana Rw1G036190 Rw3G023110 Rw4G006070 Rw6G014960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 478
AccB7I CCANNNNNTGG 1 cut(s) 184
AcsI RAATTY 2 cut(s) 22, 146
AcuI CTGAAG 1 cut(s) 261
AfiI CCNNNNNNNGG 1 cut(s) 184
AgsI TTSAA 2 cut(s) 221, 398
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
AoxI GGCC 2 cut(s) 30, 403
ApoI RAATTY 2 cut(s) 22, 146
AspS9I GGNCC 2 cut(s) 161, 403
AvaII GGWCC 1 cut(s) 161
BbsI GAAGAC 1 cut(s) 245
BccI CCATC 1 cut(s) 352
BfaI CTAG 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 471
BfuAI ACCTGC 1 cut(s) 478
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 2 cut(s) 161, 403
BmiI GGNNCC 1 cut(s) 468
BpiI GAAGAC 1 cut(s) 245
BpmI CTGGAG 1 cut(s) 68
BsaJI CCNNGG 4 cut(s) 14, 27, 183, 406
Bsc4I CCNNNNNNNGG 1 cut(s) 184
BseDI CCNNGG 4 cut(s) 14, 27, 183, 406
BseGI GGATG 2 cut(s) 344, 436
BseLI CCNNNNNNNGG 1 cut(s) 184
BshFI GGCC 2 cut(s) 32, 405
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 184
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 2 cut(s) 32, 405
Bsp19I CCATGG 1 cut(s) 183
BspANI GGCC 2 cut(s) 32, 405
BspLI GGNNCC 1 cut(s) 468
BspMAI CTGCAG 1 cut(s) 475
BspMI ACCTGC 1 cut(s) 478
BssECI CCNNGG 4 cut(s) 14, 27, 183, 406
BssT1I CCWWGG 4 cut(s) 14, 27, 183, 406
Bst4CI ACNGT 2 cut(s) 91, 115
BstC8I GCNNGC 2 cut(s) 211, 328
BstDSI CCRYGG 1 cut(s) 183
BstF5I GGATG 2 cut(s) 344, 436
BstNSI RCATGY 1 cut(s) 213
BstSFI CTRYAG 1 cut(s) 471
BstV2I GAAGAC 1 cut(s) 245
BsuRI GGCC 2 cut(s) 32, 405
BtgI CCRYGG 1 cut(s) 183
BtsCI GGATG 2 cut(s) 344, 436
BtsIMutI CAGTG 1 cut(s) 237
BveI ACCTGC 1 cut(s) 478
Cac8I GCNNGC 2 cut(s) 211, 328
Cfr13I GGNCC 2 cut(s) 161, 403
CviAII CATG 5 cut(s) 123, 179, 184, 210, 248
CviJI RGCY 5 cut(s) 5, 32, 158, 392, 405
CviKI_1 RGCY 5 cut(s) 5, 32, 158, 392, 405
Eco130I CCWWGG 4 cut(s) 14, 27, 183, 406
Eco47I GGWCC 1 cut(s) 161
Eco57I CTGAAG 1 cut(s) 261
EcoT14I CCWWGG 4 cut(s) 14, 27, 183, 406
ErhI CCWWGG 4 cut(s) 14, 27, 183, 406
FaeI CATG 5 cut(s) 126, 182, 187, 213, 251
FalI AAGNNNNNCTT 2 cut(s) 390, 422
FaqI GGGAC 1 cut(s) 116
FatI CATG 5 cut(s) 122, 178, 183, 209, 247
FokI GGATG 2 cut(s) 331, 443
FspBI CTAG 1 cut(s) 155
GsuI CTGGAG 1 cut(s) 68
HaeIII GGCC 2 cut(s) 32, 405
Hin1II CATG 5 cut(s) 126, 182, 187, 213, 251
HinfI GANTC 2 cut(s) 134, 485
Hpy188III TCNNGA 3 cut(s) 47, 267, 489
HpyAV CCTTC 1 cut(s) 352
HpyCH4III ACNGT 2 cut(s) 91, 115
HpyCH4V TGCA 5 cut(s) 108, 213, 330, 374, 473
Hsp92II CATG 5 cut(s) 126, 182, 187, 213, 251
LpnPI CCDG 7 cut(s) 32, 87, 144, 252, 340, 426, 483
MaeI CTAG 1 cut(s) 155
MboII GAAGA 4 cut(s) 245, 254, 375, 412
MluCI AATT 4 cut(s) 22, 36, 146, 319
MlyI GAGTC 1 cut(s) 143
MmeI TCCRAC 1 cut(s) 444
MnlI CCTC 2 cut(s) 199, 404
MseI TTAA 1 cut(s) 282
MslI CAYNNNNRTG 1 cut(s) 38
NcoI CCATGG 1 cut(s) 183
NlaIII CATG 5 cut(s) 126, 182, 187, 213, 251
NlaIV GGNNCC 1 cut(s) 468
NspI RCATGY 1 cut(s) 213
PaeI GCATGC 1 cut(s) 213
PflMI CCANNNNNTGG 1 cut(s) 184
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 468
PspPI GGNCC 2 cut(s) 161, 403
PstI CTGCAG 1 cut(s) 475
RseI CAYNNNNRTG 1 cut(s) 38
SaqAI TTAA 1 cut(s) 282
Sau96I GGNCC 2 cut(s) 161, 403
SchI GAGTC 1 cut(s) 143
SetI ASST 3 cut(s) 160, 166, 472
SfcI CTRYAG 1 cut(s) 471
SinI GGWCC 1 cut(s) 161
SmiMI CAYNNNNRTG 1 cut(s) 38
SphI GCATGC 1 cut(s) 213
Sse9I AATT 4 cut(s) 22, 36, 146, 319
SspI AATATT 1 cut(s) 130
SspMI CTAG 1 cut(s) 155
StyI CCWWGG 4 cut(s) 14, 27, 183, 406
TaaI ACNGT 2 cut(s) 91, 115
TasI AATT 4 cut(s) 22, 36, 146, 319
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 3 cut(s) 99, 412, 447
TspGWI ACGGA 1 cut(s) 439
TspRI CASTG 1 cut(s) 244
Van91I CCANNNNNTGG 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 2 cut(s) 22, 146
XceI RCATGY 1 cut(s) 213
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.