Rmu_sc0022770.1_g000001

zinc finger CCCH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022770.1
OG0000488
Physical Location & Seq
Reverse (-)
7591 .. 8823
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022770.1_g000001.1.cds

Sequence Viewer

Length: 1233 bp
atggctctcagggtatcgaattccagactcacaagaagacctgcttccgaaaccgtctgcaagttttgggcgatgggtagatgcctcaagaaagagtgccggttcctacacgctgacccggaacaaaagactcttgctttaatggaggagaaggccaaatctattgggaaagcatctgattctgctactgttaatgttcatgttgagaaaagcattggtacccataaagagaaagcagaggccgaagcagtctgcaagttctgggcagaaggaaagtgtgtaagacgagggtgcccttatctgcacagttggttccgtggagatggcttttcttccttggtaaagctccaaggccataagaaggggataaccggaattgtgcttcccgagggaagtagcagtctctattctgctgccaaagacggaaccgttagggtttgggactgcaatactggtgaatgcagcagggtcatcaatcttggtgcggaagctggctgcttgattagtaagggtgtgtggattttctgcggtgcttccaatctcgtcaaggcgtggaatattgagtccaattctgaatttaccttagctggatctgttggtcaaatccatgccatggaaattgggaatgacatggtattcgctggggcagaggagggtgttatatatgtgtggaaaggcaaagcctgttccgatgctaaagcgaatccatttcaccctcatcaggctctcagtggccacactgctgctgtggtttctttaagggttggaaacatcagactctactcgggttctacggaccatacaataagggtgtggaatctggacactttggagtgtgctatgactctaaatggacattctgatgctgtgacgtctcttatttgttggaccacatttctgatctcatgctcattagaccacacgataaaggtgtggactatgtgtaaaggaggcaacattgaagaaatctacactcacactgaagaagacggtcttcttgctctctctggaatgcatgatgctgaagacaaaccagtcctactttgctcatcaaaagacaattctgtccgcatatatgatttgccatcctttgatgagaggggaagattatttgcaaaacgggaagttcgggctattcaagttggccctggaggactattctttactggggatgaaactggtggactctccgtgtggaagtggttgcaacctgcagtcaaacaagagtcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04120 map03040 map04120
Pfam Domains
Protein Families
WD40 zf-CCCH

Protein Analysis

410

Amino Acids

44.82

Weight (kDa)

7.53

Isoelectric Point (pI)

40.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000488)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G25440 AT4G25440 AT4G25440 AT5G51980 AT5G51980
fragaria_vesca FvH4_2g11580 FvH4_3g29280 FvH4_4g05980 FvH4_7g28880 FvH4_7g28880
malus_domestica MD01G1195600.v1.1 MD02G1195200.v1.1 MD07G1262400.v1.1
prunus_persica Prupe.2G102200_v2.0.a1 Prupe.2G102200_v2.0.a1 Prupe.2G120800_v2.0.a1 Prupe.2G120800_v2.0.a1 Prupe.2G153300_v2.0.a1 Prupe.2G153300_v2.0.a1 Prupe.2G153400_v2.0.a1 Prupe.2G153400_v2.0.a1 Prupe.2G288900_v2.0.a1
pyrus_communis pycom01g20620 pycom02g15900 pycom07g24140
rosa_chinensis RchiOBHm_Chr1g0376561 RchiOBHm_Chr3g0483051 RchiOBHm_Chr3g0483061 RchiOBHm_Chr3g0483601 RchiOBHm_Chr3g0483611 RchiOBHm_Chr4g0402321 RchiOBHm_Chr6g0270771
rosa_laevigata RLG00000009464 RLG00000009486 RLG00000013770 RLG00000023264 RLG00000023325 RLG00000026601 RLG00000035049
rosa_multiflora Rmu_co8110388.1_g000001 Rmu_co8419409.1_g000001 Rmu_sc0000555.1_g000012 Rmu_sc0000642.1_g000020 Rmu_sc0001308.1_g000010 Rmu_sc0002963.1_g000021 Rmu_sc0004788.1_g000012 Rmu_sc0005594.1_g000015 Rmu_sc0022770.1_g000001
rosa_roxburghii Rroxscaffold_4G00282000 Rroxscaffold_5G00341940 Rroxscaffold_5G00341950 Rroxscaffold_6G00398950 Rroxscaffold_7G00197610
rosa_rugosa Rorug01G0396500 Rorug03G0207400 Rorug03G0346000 Rorug04G0166800 Rorug06G0056400 Rorug06G0056500
rosa_samantha Rh1AG412700 Rh1BG372400 Rh1BG372600 Rh1CG386200 Rh1CG386500 Rh1DG403300 Rh1DG403500 Rh3AG255500 Rh3AG255600 Rh3BG292600 Rh3CG290200 Rh3DG278800 Rh3DG286100 Rh4AG075500 Rh4AG111600 Rh4BG071900 Rh4BG072100 Rh4BG231300 Rh4CG080200 Rh4CG080300 Rh4DG069300 Rh4DG069500 Rh6AG175700 Rh6BG178900 Rh6CG175200 Rh6DG167500
rosa_wichuraiana Rw1G036190 Rw3G023110 Rw4G006070 Rw6G014960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 1034, 1064
AatII GACGTC 1 cut(s) 875
Acc36I ACCTGC 2 cut(s) 49, 1219
Acc65I GGTACC 1 cut(s) 218
AccB1I GGYRCC 2 cut(s) 218, 291
AccB7I CCANNNNNTGG 1 cut(s) 613
AciI CCGC 3 cut(s) 485, 528, 1069
AclWI GGATC 1 cut(s) 598
AcoI YGGCCR 1 cut(s) 733
AcsI RAATTY 2 cut(s) 19, 575
AcuI CTGAAG 2 cut(s) 1002, 1044
AcyI GRCGYC 1 cut(s) 872
AfaI GTAC 1 cut(s) 220
AfiI CCNNNNNNNGG 3 cut(s) 361, 613, 721
AgsI TTSAA 2 cut(s) 962, 1139
AjnI CCWGG 1 cut(s) 1147
AluBI AGCT 3 cut(s) 346, 491, 587
AluI AGCT 3 cut(s) 346, 491, 587
Alw26I GTCTC 2 cut(s) 407, 879
AlwI GGATC 1 cut(s) 598
Ama87I CYCGRG 2 cut(s) 386, 784
AoxI GGCC 5 cut(s) 153, 240, 352, 733, 1144
ApeKI GCWGC 4 cut(s) 413, 462, 495, 743
ApoI RAATTY 2 cut(s) 19, 575
ArsI GACNNNNNNTTYG 2 cut(s) 620, 652
Asp718I GGTACC 1 cut(s) 218
AspS9I GGNCC 3 cut(s) 796, 888, 1145
AsuC2I CCSGG 1 cut(s) 119
AsuHPI GGTGA 2 cut(s) 467, 704
AvaI CYCGRG 2 cut(s) 386, 784
AvaII GGWCC 2 cut(s) 796, 888
BaeGI GKGCMC 1 cut(s) 296
BalI TGGCCA 1 cut(s) 735
BanI GGYRCC 2 cut(s) 218, 291
BbsI GAAGAC 4 cut(s) 43, 986, 993, 1032
BbvI GCAGC 4 cut(s) 400, 474, 482, 730
BccI CCATC 3 cut(s) 67, 317, 1093
BciT130I CCWGG 1 cut(s) 1149
BcnI CCSGG 1 cut(s) 119
BcoDI GTCTC 2 cut(s) 407, 879
BfmI CTRYAG 1 cut(s) 1212
BfuAI ACCTGC 2 cut(s) 49, 1219
BisI GCNGC 4 cut(s) 414, 463, 496, 744
BlsI GCNGC 4 cut(s) 415, 464, 497, 745
Bme1390I CCNGG 2 cut(s) 119, 1149
Bme18I GGWCC 2 cut(s) 796, 888
BmeT110I CYCGRG 2 cut(s) 386, 784
BmgT120I GGNCC 3 cut(s) 796, 888, 1145
BmiI GGNNCC 5 cut(s) 104, 220, 293, 314, 427
BmrFI CCNGG 2 cut(s) 119, 1149
BmrI ACTGGG 1 cut(s) 1176
BmsI GCATC 5 cut(s) 71, 182, 682, 853, 1009
BmuI ACTGGG 1 cut(s) 1176
BpiI GAAGAC 4 cut(s) 43, 986, 993, 1032
BpmI CTGGAG 1 cut(s) 1170
Bpu10I CCTNAGC 1 cut(s) 583
BpuEI CTTGAG 1 cut(s) 71
BpuMI CCSGG 1 cut(s) 119
BsaHI GRCGYC 1 cut(s) 872
BsaJI CCNNGG 6 cut(s) 316, 336, 349, 387, 612, 1147
BsaWI WCCGGW 1 cut(s) 371
Bsc4I CCNNNNNNNGG 3 cut(s) 361, 613, 721
Bse118I RCCGGY 1 cut(s) 99
Bse1I ACTGG 4 cut(s) 457, 1034, 1171, 1183
BseBI CCWGG 1 cut(s) 1149
BseDI CCNNGG 6 cut(s) 316, 336, 349, 387, 612, 1147
BseGI GGATG 2 cut(s) 1085, 1177
BseLI CCNNNNNNNGG 3 cut(s) 361, 613, 721
BseMII CTCAG 2 cut(s) 22, 742
BseNI ACTGG 4 cut(s) 457, 1034, 1171, 1183
BseRI GAGGAG 2 cut(s) 161, 665
BseSI GKGCMC 1 cut(s) 296
BseXI GCAGC 4 cut(s) 400, 474, 482, 730
BseYI CCCAGC 1 cut(s) 641
BsgI GTGCAG 1 cut(s) 287
BshFI GGCC 5 cut(s) 155, 242, 354, 735, 1146
BshNI GGYRCC 2 cut(s) 218, 291
BsiHKCI CYCGRG 2 cut(s) 386, 784
BsiSI CCGG 3 cut(s) 100, 119, 372
BslFI GGGAC 1 cut(s) 455
BslI CCNNNNNNNGG 3 cut(s) 361, 613, 721
BsmAI GTCTC 2 cut(s) 407, 879
BsmBI CGTCTC 1 cut(s) 879
BsmFI GGGAC 1 cut(s) 455
BsmI GAATGC 2 cut(s) 464, 1017
BsnI GGCC 5 cut(s) 155, 242, 354, 735, 1146
BsoBI CYCGRG 2 cut(s) 386, 784
Bsp1286I GDGCHC 1 cut(s) 296
Bsp143I GATC 2 cut(s) 590, 900
Bsp19I CCATGG 1 cut(s) 612
BspACI CCGC 3 cut(s) 485, 528, 1069
BspANI GGCC 5 cut(s) 155, 242, 354, 735, 1146
BspCNI CTCAG 2 cut(s) 21, 741
BspLI GGNNCC 5 cut(s) 104, 220, 293, 314, 427
BspMAI CTGCAG 1 cut(s) 1216
BspMI ACCTGC 2 cut(s) 49, 1219
BspPI GGATC 1 cut(s) 598
BspT107I GGYRCC 2 cut(s) 218, 291
BsrFI RCCGGY 1 cut(s) 99
BsrI ACTGG 4 cut(s) 457, 1034, 1171, 1183
BssAI RCCGGY 1 cut(s) 99
BssECI CCNNGG 6 cut(s) 316, 336, 349, 387, 612, 1147
BssMI GATC 2 cut(s) 590, 900
BssNI GRCGYC 1 cut(s) 872
BssT1I CCWWGG 3 cut(s) 336, 349, 612
Bst2UI CCWGG 1 cut(s) 1149
Bst4CI ACNGT 5 cut(s) 55, 190, 308, 430, 992
BstACI GRCGYC 1 cut(s) 872
BstC8I GCNNGC 1 cut(s) 493
BstDEI CTNAG 3 cut(s) 8, 583, 728
BstDSI CCRYGG 2 cut(s) 316, 612
BstF5I GGATG 2 cut(s) 1085, 1177
BstKTI GATC 2 cut(s) 593, 903
BstMAI GTCTC 2 cut(s) 407, 879
BstMBI GATC 2 cut(s) 590, 900
BstNI CCWGG 1 cut(s) 1149
BstSCI CCNGG 2 cut(s) 117, 1147
BstSFI CTRYAG 1 cut(s) 1212
BstSLI GKGCMC 1 cut(s) 296
BstV1I GCAGC 4 cut(s) 400, 474, 482, 730
BstV2I GAAGAC 4 cut(s) 43, 986, 993, 1032
BstX2I RGATCY 1 cut(s) 590
BstYI RGATCY 1 cut(s) 590
BsuRI GGCC 5 cut(s) 155, 242, 354, 735, 1146
BtgI CCRYGG 2 cut(s) 316, 612
BtgZI GCGATG 1 cut(s) 86
BtsCI GGATG 2 cut(s) 1085, 1177
BtsI GCAGTG 1 cut(s) 738
BtsIMutI CAGTG 3 cut(s) 736, 738, 978
BveI ACCTGC 2 cut(s) 49, 1219
Cac8I GCNNGC 1 cut(s) 493
Cfr10I RCCGGY 1 cut(s) 99
Cfr13I GGNCC 3 cut(s) 796, 888, 1145
Csp6I GTAC 1 cut(s) 219
CviAII CATG 6 cut(s) 200, 608, 613, 631, 906, 1016
CviQI GTAC 1 cut(s) 219
DdeI CTNAG 3 cut(s) 8, 583, 728
DpnI GATC 2 cut(s) 592, 902
DpnII GATC 2 cut(s) 590, 900
DrdI GACNNNNNNGTC 2 cut(s) 1034, 1064
DseDI GACNNNNNNGTC 2 cut(s) 1034, 1064
EaeI YGGCCR 1 cut(s) 733
Eco130I CCWWGG 3 cut(s) 336, 349, 612
Eco47I GGWCC 2 cut(s) 796, 888
Eco57I CTGAAG 2 cut(s) 1002, 1044
Eco88I CYCGRG 2 cut(s) 386, 784
EcoRI GAATTC 1 cut(s) 19
EcoRII CCWGG 1 cut(s) 1147
EcoT14I CCWWGG 3 cut(s) 336, 349, 612
EcoT22I ATGCAT 1 cut(s) 1017
ErhI CCWWGG 3 cut(s) 336, 349, 612
Esp3I CGTCTC 1 cut(s) 879
FaeI CATG 6 cut(s) 203, 611, 616, 634, 909, 1019
FalI AAGNNNNNCTT 4 cut(s) 28, 60, 978, 1010
FaqI GGGAC 1 cut(s) 455
FatI CATG 6 cut(s) 199, 607, 612, 630, 905, 1015
Fnu4HI GCNGC 4 cut(s) 414, 463, 496, 744
FokI GGATG 2 cut(s) 1072, 1184
Fsp4HI GCNGC 4 cut(s) 414, 463, 496, 744
GluI GCNGC 4 cut(s) 414, 463, 496, 744
GsaI CCCAGC 1 cut(s) 645
GsuI CTGGAG 1 cut(s) 1170
HaeIII GGCC 5 cut(s) 155, 242, 354, 735, 1146
HapII CCGG 3 cut(s) 100, 119, 372
Hin1I GRCGYC 1 cut(s) 872
Hin1II CATG 6 cut(s) 203, 611, 616, 634, 909, 1019
HpaII CCGG 3 cut(s) 100, 119, 372
HphI GGTGA 2 cut(s) 467, 704
Hpy166II GTNNAC 2 cut(s) 936, 1184
Hpy188I TCNGA 7 cut(s) 49, 178, 574, 691, 776, 862, 900
Hpy188III TCNNGA 6 cut(s) 24, 88, 386, 821, 1008, 1230
Hpy8I GTNNAC 2 cut(s) 936, 1184
HpyAV CCTTC 3 cut(s) 145, 263, 355
HpyCH4III ACNGT 5 cut(s) 55, 190, 308, 430, 992
HpyCH4IV ACGT 1 cut(s) 872
HpyCH4V TGCA 9 cut(s) 60, 255, 304, 447, 462, 1015, 1115, 1207, 1214
HpyF3I CTNAG 3 cut(s) 8, 583, 728
HpySE526I ACGT 1 cut(s) 872
Hsp92I GRCGYC 1 cut(s) 872
Hsp92II CATG 6 cut(s) 203, 611, 616, 634, 909, 1019
KpnI GGTACC 1 cut(s) 222
Kzo9I GATC 2 cut(s) 590, 900
LmnI GCTCC 1 cut(s) 351
Lsp1109I GCAGC 4 cut(s) 400, 474, 482, 730
LweI GCATC 5 cut(s) 71, 182, 682, 853, 1009
MaeII ACGT 1 cut(s) 872
MaeIII GTNAC 1 cut(s) 868
MalI GATC 2 cut(s) 592, 902
MboI GATC 2 cut(s) 590, 900
MboII GAAGA 8 cut(s) 48, 324, 974, 986, 995, 998, 1037, 1116
MflI RGATCY 1 cut(s) 590
MhlI GDGCHC 1 cut(s) 296
MlsI TGGCCA 1 cut(s) 735
MluCI AATT 6 cut(s) 19, 375, 568, 575, 618, 1060
MluNI TGGCCA 1 cut(s) 735
MlyI GAGTC 6 cut(s) 21, 124, 572, 771, 838, 1179
MmeI TCCRAC 2 cut(s) 745, 866
Mox20I TGGCCA 1 cut(s) 735
Mph1103I ATGCAT 1 cut(s) 1017
MscI TGGCCA 1 cut(s) 735
MseI TTAA 3 cut(s) 140, 192, 758
MslI CAYNNNNRTG 1 cut(s) 861
Msp20I TGGCCA 1 cut(s) 735
MspI CCGG 3 cut(s) 100, 119, 372
MspR9I CCNGG 2 cut(s) 119, 1149
Mva1269I GAATGC 2 cut(s) 464, 1017
MvaI CCWGG 1 cut(s) 1149
NciI CCSGG 1 cut(s) 119
NcoI CCATGG 1 cut(s) 612
NdeII GATC 2 cut(s) 590, 900
NlaIII CATG 6 cut(s) 203, 611, 616, 634, 909, 1019
NlaIV GGNNCC 5 cut(s) 104, 220, 293, 314, 427
NmuCI GTSAC 1 cut(s) 868
NsiI ATGCAT 1 cut(s) 1017
PctI GAATGC 2 cut(s) 464, 1017
PfeI GAWTC 3 cut(s) 179, 703, 817
PflMI CCANNNNNTGG 1 cut(s) 613
PkrI GCNGC 4 cut(s) 415, 464, 497, 745
PleI GAGTC 6 cut(s) 21, 124, 571, 771, 838, 1179
PpsI GAGTC 6 cut(s) 21, 124, 571, 771, 838, 1179
Psp6I CCWGG 1 cut(s) 1147
PspFI CCCAGC 1 cut(s) 641
PspGI CCWGG 1 cut(s) 1147
PspN4I GGNNCC 5 cut(s) 104, 220, 293, 314, 427
PspPI GGNCC 3 cut(s) 796, 888, 1145
PstI CTGCAG 1 cut(s) 1216
PsuI RGATCY 1 cut(s) 590
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
RseI CAYNNNNRTG 1 cut(s) 861
SaqAI TTAA 3 cut(s) 140, 192, 758
SatI GCNGC 4 cut(s) 414, 463, 496, 744
Sau3AI GATC 2 cut(s) 590, 900
Sau96I GGNCC 3 cut(s) 796, 888, 1145
SchI GAGTC 6 cut(s) 21, 124, 572, 771, 838, 1179
ScrFI CCNGG 2 cut(s) 119, 1149
SduI GDGCHC 1 cut(s) 296
SetI ASST 8 cut(s) 43, 348, 493, 584, 589, 875, 933, 1213
SfaNI GCATC 5 cut(s) 71, 182, 682, 853, 1009
SfcI CTRYAG 1 cut(s) 1212
SinI GGWCC 2 cut(s) 796, 888
SmiMI CAYNNNNRTG 1 cut(s) 861
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 6 cut(s) 19, 375, 568, 575, 618, 1060
SsiI CCGC 3 cut(s) 485, 528, 1069
SspI AATATT 1 cut(s) 559
StyD4I CCNGG 2 cut(s) 117, 1147
StyI CCWWGG 3 cut(s) 336, 349, 612
TaaI ACNGT 5 cut(s) 55, 190, 308, 430, 992
TaiI ACGT 1 cut(s) 875
TaqI TCGA 1 cut(s) 17
TasI AATT 6 cut(s) 19, 375, 568, 575, 618, 1060
TfiI GAWTC 3 cut(s) 179, 703, 817
Tru1I TTAA 3 cut(s) 140, 192, 758
Tru9I TTAA 3 cut(s) 140, 192, 758
TscAI CASTG 3 cut(s) 736, 745, 985
TseFI GTSAC 1 cut(s) 868
TseI GCWGC 4 cut(s) 413, 462, 495, 743
Tsp45I GTSAC 1 cut(s) 868
TspDTI ATGAA 2 cut(s) 188, 1188
TspGWI ACGGA 4 cut(s) 305, 438, 809, 1180
TspRI CASTG 3 cut(s) 736, 745, 985
Van91I CCANNNNNTGG 1 cut(s) 613
VpaK11BI GGWCC 2 cut(s) 796, 888
XapI RAATTY 2 cut(s) 19, 575
ZraI GACGTC 1 cut(s) 873
Zsp2I ATGCAT 1 cut(s) 1017
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.