Rmu_sc0000361.1_g000030

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000361.1
Physical Location & Seq
Forward (+)
155739 .. 156143
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000361.1_g000030.1.cds

Sequence Viewer

Length: 405 bp
atgtttaaatatgtggagctttgtgttgacttgcgcaagggtagatttgccaaggatggtctgattcagtaccgtattatatgtcaacaagtaaatgtcagttccttggaagaggtgatcaagcacttcatgcatctgtcaactgagaaagctgagcaggcacgtacccaggctcaagcattagaagaagcacttgatgttgatgacctcgaagcagataagaggcctgaagatctaatgctgagttatgtcagtgaagagaaaggaaaagataggtctgatcgtgaagttgttactccttggttcaagtttttgtgggaaacctacagaacagtgcttgagatcttgcgcaacaactcaaagttggaggccctttatgcggtactgtatttcttgtttagataa

Protein Analysis

134

Amino Acids

15.9

Weight (kDa)

5.3

Isoelectric Point (pI)

31.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 35, 350
AciI CCGC 1 cut(s) 380
AcuI CTGAAG 1 cut(s) 249
AfaI GTAC 3 cut(s) 71, 166, 384
AfiI CCNNNNNNNGG 1 cut(s) 379
AgsI TTSAA 1 cut(s) 307
AjnI CCWGG 1 cut(s) 168
AluBI AGCT 2 cut(s) 19, 152
AluI AGCT 2 cut(s) 19, 152
AoxI GGCC 2 cut(s) 224, 369
AspLEI GCGC 2 cut(s) 36, 351
AspS9I GGNCC 1 cut(s) 370
AsuHPI GGTGA 1 cut(s) 127
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 170
BclI TGATCA 1 cut(s) 117
BfmI CTRYAG 1 cut(s) 325
BglII AGATCT 2 cut(s) 232, 342
BlpI GCTNAGC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 370
BmrFI CCNGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 142
Bpu1102I GCTNAGC 1 cut(s) 153
BpuEI CTTGAG 2 cut(s) 159, 359
BsaAI YACGTR 1 cut(s) 164
BsaJI CCNNGG 4 cut(s) 51, 105, 168, 299
Bsc4I CCNNNNNNNGG 1 cut(s) 379
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 4 cut(s) 51, 105, 168, 299
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 379
BseMII CTCAG 3 cut(s) 135, 144, 233
BshFI GGCC 2 cut(s) 226, 371
BslI CCNNNNNNNGG 1 cut(s) 379
BsnI GGCC 2 cut(s) 226, 371
Bsp143I GATC 4 cut(s) 117, 232, 280, 342
Bsp1720I GCTNAGC 1 cut(s) 153
BspACI CCGC 1 cut(s) 380
BspANI GGCC 2 cut(s) 226, 371
BspCNI CTCAG 3 cut(s) 136, 145, 234
BssECI CCNNGG 4 cut(s) 51, 105, 168, 299
BssMI GATC 4 cut(s) 117, 232, 280, 342
BssT1I CCWWGG 3 cut(s) 51, 105, 299
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 3 cut(s) 74, 334, 387
Bst6I CTCTTC 2 cut(s) 105, 252
BstAPI GCANNNNNTGC 1 cut(s) 130
BstBAI YACGTR 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 3 cut(s) 144, 153, 242
BstF5I GGATG 1 cut(s) 61
BstHHI GCGC 2 cut(s) 36, 351
BstKTI GATC 4 cut(s) 120, 235, 283, 345
BstMBI GATC 4 cut(s) 117, 232, 280, 342
BstMWI GCNNNNNNNGC 3 cut(s) 130, 158, 377
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstSFI CTRYAG 1 cut(s) 325
BstX2I RGATCY 2 cut(s) 232, 342
BstYI RGATCY 2 cut(s) 232, 342
BsuRI GGCC 2 cut(s) 226, 371
BtsCI GGATG 1 cut(s) 61
BtsIMutI CAGTG 2 cut(s) 259, 339
Cac8I GCNNGC 1 cut(s) 159
CfoI GCGC 2 cut(s) 36, 351
Cfr13I GGNCC 1 cut(s) 370
Csp6I GTAC 3 cut(s) 70, 165, 383
CviAII CATG 1 cut(s) 130
CviJI RGCY 5 cut(s) 19, 152, 173, 226, 371
CviKI_1 RGCY 5 cut(s) 19, 152, 173, 226, 371
CviQI GTAC 3 cut(s) 70, 165, 383
DdeI CTNAG 3 cut(s) 144, 153, 242
DpnI GATC 4 cut(s) 119, 234, 282, 344
DpnII GATC 4 cut(s) 117, 232, 280, 342
DraI TTTAAA 1 cut(s) 7
Eam1104I CTCTTC 2 cut(s) 105, 252
EarI CTCTTC 2 cut(s) 105, 252
Eco130I CCWWGG 3 cut(s) 51, 105, 299
Eco147I AGGCCT 1 cut(s) 226
Eco57I CTGAAG 1 cut(s) 249
EcoO109I RGGNCCY 1 cut(s) 370
EcoRII CCWGG 1 cut(s) 168
EcoT14I CCWWGG 3 cut(s) 51, 105, 299
EcoT22I ATGCAT 1 cut(s) 135
ErhI CCWWGG 3 cut(s) 51, 105, 299
FaeI CATG 1 cut(s) 133
FaiI YATR 6 cut(s) 12, 80, 82, 131, 249, 378
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FatI CATG 1 cut(s) 129
FbaI TGATCA 1 cut(s) 117
FokI GGATG 1 cut(s) 68
FspI TGCGCA 2 cut(s) 35, 350
GlaI GCGC 2 cut(s) 35, 350
HaeIII GGCC 2 cut(s) 226, 371
HhaI GCGC 2 cut(s) 36, 351
Hin1II CATG 1 cut(s) 133
Hin6I GCGC 2 cut(s) 34, 349
HinP1I GCGC 2 cut(s) 34, 349
HincII GTYRAC 3 cut(s) 28, 86, 141
HindII GTYRAC 3 cut(s) 28, 86, 141
HinfI GANTC 1 cut(s) 64
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 3 cut(s) 28, 86, 141
Hpy188I TCNGA 2 cut(s) 63, 280
Hpy188III TCNNGA 1 cut(s) 284
Hpy8I GTNNAC 3 cut(s) 28, 86, 141
HpyCH4III ACNGT 3 cut(s) 74, 334, 387
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 3 cut(s) 130, 158, 377
HpyF3I CTNAG 3 cut(s) 144, 153, 242
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 1 cut(s) 133
HspAI GCGC 2 cut(s) 34, 349
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 4 cut(s) 117, 232, 280, 342
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 4 cut(s) 143, 155, 182, 240
LweI GCATC 1 cut(s) 142
MaeII ACGT 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 292
MalI GATC 4 cut(s) 119, 234, 282, 344
MboI GATC 4 cut(s) 117, 232, 280, 342
MboII GAAGA 4 cut(s) 122, 197, 242, 269
MflI RGATCY 2 cut(s) 232, 342
MmeI TCCRAC 1 cut(s) 345
MnlI CCTC 4 cut(s) 106, 216, 218, 361
Mph1103I ATGCAT 1 cut(s) 135
MseI TTAA 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 170
MvaI CCWGG 1 cut(s) 170
MwoI GCNNNNNNNGC 3 cut(s) 130, 158, 377
NdeII GATC 4 cut(s) 117, 232, 280, 342
NlaIII CATG 1 cut(s) 133
NsbI TGCGCA 2 cut(s) 35, 350
NsiI ATGCAT 1 cut(s) 135
PceI AGGCCT 1 cut(s) 226
PfeI GAWTC 1 cut(s) 64
Ppu21I YACGTR 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspPI GGNCC 1 cut(s) 370
PsuI RGATCY 2 cut(s) 232, 342
RsaI GTAC 3 cut(s) 71, 166, 384
RsaNI GTAC 3 cut(s) 70, 165, 383
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 4 cut(s) 117, 232, 280, 342
Sau96I GGNCC 1 cut(s) 370
ScrFI CCNGG 1 cut(s) 170
SetI ASST 7 cut(s) 21, 117, 154, 166, 210, 278, 326
SfaNI GCATC 1 cut(s) 142
SfcI CTRYAG 1 cut(s) 325
SmlI CTYRAG 2 cut(s) 174, 338
SmoI CTYRAG 2 cut(s) 174, 338
SseBI AGGCCT 1 cut(s) 226
SsiI CCGC 1 cut(s) 380
StuI AGGCCT 1 cut(s) 226
StyD4I CCNGG 1 cut(s) 168
StyI CCWWGG 3 cut(s) 51, 105, 299
TaaI ACNGT 3 cut(s) 74, 334, 387
TaiI ACGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 210
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 2 cut(s) 259, 339
TspDTI ATGAA 1 cut(s) 118
TspRI CASTG 2 cut(s) 259, 339
Zsp2I ATGCAT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.