Rmu_sc0000955.1_g000029

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000955.1
Physical Location & Seq
Reverse (-)
152142 .. 154246
2105 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000955.1_g000029.1.cds

Sequence Viewer

Length: 861 bp
atggcgaattttgcaaaaccggaaaatgctttgaagcgagctgaagagttgatcaatgttgggcagaagcaagatgcattgcaatcgcttcatgatcttattacatcaaagagatatagagcatggcagaagccacttgaaaaaattatgtttaaatatgtggagctttgtgttgacttgcgcaagggtagatttgccaaggatggtctgattcagtaccgtattatatgtcaacaagtaaatgtcagttccttggaagaggtgatcaagcacttcatgcatctgtcaactgagaaagctgagcaggcacgtacccaggctcaagcattagaagaagcacttgatgttgatgacctcgaagcagataagaggcctgaagatctaatgctgagttatgtcagtgaagagaaaggaaaagataggtctgatcgtgaagttgttactccttggttcaagtttttgtgggaaacctacagaacagtgcttgagatcttgcgcaacaactcaaagttggaggccctttatgcggcaaaagctaatgagggagagggtccagaaattctaagaagtgcgcatgaaggcagttcaagtggtcatgccgagtcattagctgcaacactagctgaacatcagcagcacttcctatatgttcgggtacttggtgcattttacttgcgtatcacaggcagcgatactgatgtctaccagtacctagagcctctgtacaatgactatcggaagttgagaagtaaattggctgatggacgtttctcgttgactcatgtggatgagcttattgatgaacttctgacaaaggactactcatgcgacattgccatgccacgaatcaagaaaaggtaa

Protein Analysis

286

Amino Acids

33.09

Weight (kDa)

5.97

Isoelectric Point (pI)

36.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 3 cut(s) 182, 497, 573
AccI GTMKAC 1 cut(s) 702
AciI CCGC 1 cut(s) 527
AcsI RAATTY 2 cut(s) 7, 558
AcuI CTGAAG 2 cut(s) 63, 396
AfaI GTAC 5 cut(s) 218, 313, 657, 710, 725
AfiI CCNNNNNNNGG 1 cut(s) 526
AgsI TTSAA 4 cut(s) 34, 140, 454, 588
AjnI CCWGG 1 cut(s) 315
AluBI AGCT 7 cut(s) 41, 166, 299, 536, 611, 623, 793
AluI AGCT 7 cut(s) 41, 166, 299, 536, 611, 623, 793
AoxI GGCC 2 cut(s) 371, 516
ApeKI GCWGC 3 cut(s) 611, 634, 687
ApoI RAATTY 2 cut(s) 7, 558
AspLEI GCGC 3 cut(s) 183, 498, 574
AspS9I GGNCC 2 cut(s) 517, 551
AsuHPI GGTGA 1 cut(s) 274
AvaII GGWCC 1 cut(s) 551
BaeI ACNNNNGTAYC 4 cut(s) 661, 684, 694, 717
BbvI GCAGC 3 cut(s) 598, 646, 699
BccI CCATC 2 cut(s) 197, 755
BcgI CGANNNNNNTGC 2 cut(s) 66, 100
BciT130I CCWGG 1 cut(s) 317
BclI TGATCA 2 cut(s) 51, 264
BfaI CTAG 2 cut(s) 620, 713
BfmI CTRYAG 1 cut(s) 472
BglII AGATCT 2 cut(s) 379, 489
BisI GCNGC 4 cut(s) 528, 612, 635, 688
BlpI GCTNAGC 1 cut(s) 300
BlsI GCNGC 4 cut(s) 529, 613, 636, 689
Bme1390I CCNGG 1 cut(s) 317
Bme18I GGWCC 1 cut(s) 551
BmgT120I GGNCC 2 cut(s) 517, 551
BmiI GGNNCC 1 cut(s) 552
BmrFI CCNGG 1 cut(s) 317
BmsI GCATC 2 cut(s) 64, 289
Bpu1102I GCTNAGC 1 cut(s) 300
BpuEI CTTGAG 2 cut(s) 306, 506
BsaAI YACGTR 1 cut(s) 311
BsaJI CCNNGG 4 cut(s) 198, 252, 315, 446
BsaWI WCCGGW 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 526
Bse1I ACTGG 1 cut(s) 706
Bse3DI GCAATG 2 cut(s) 77, 831
BseBI CCWGG 1 cut(s) 317
BseDI CCNNGG 4 cut(s) 198, 252, 315, 446
BseGI GGATG 2 cut(s) 208, 793
BseLI CCNNNNNNNGG 1 cut(s) 526
BseMI GCAATG 2 cut(s) 77, 831
BseMII CTCAG 3 cut(s) 282, 291, 380
BseNI ACTGG 1 cut(s) 706
BseXI GCAGC 3 cut(s) 598, 646, 699
BshFI GGCC 2 cut(s) 373, 518
BsiSI CCGG 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 526
BsnI GGCC 2 cut(s) 373, 518
Bsp1407I TGTACA 1 cut(s) 723
Bsp143I GATC 6 cut(s) 51, 94, 264, 379, 427, 489
Bsp1720I GCTNAGC 1 cut(s) 300
BspACI CCGC 1 cut(s) 527
BspANI GGCC 2 cut(s) 373, 518
BspCNI CTCAG 3 cut(s) 283, 292, 381
BspHI TCATGA 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 552
BsrDI GCAATG 2 cut(s) 77, 831
BsrGI TGTACA 1 cut(s) 723
BsrI ACTGG 1 cut(s) 706
BssECI CCNNGG 4 cut(s) 198, 252, 315, 446
BssMI GATC 6 cut(s) 51, 94, 264, 379, 427, 489
BssT1I CCWWGG 3 cut(s) 198, 252, 446
Bst2UI CCWGG 1 cut(s) 317
Bst4CI ACNGT 2 cut(s) 221, 481
Bst6I CTCTTC 3 cut(s) 39, 252, 399
BstAPI GCANNNNNTGC 1 cut(s) 277
BstAUI TGTACA 1 cut(s) 723
BstBAI YACGTR 1 cut(s) 311
BstC8I GCNNGC 2 cut(s) 39, 306
BstDEI CTNAG 4 cut(s) 291, 300, 389, 563
BstF5I GGATG 2 cut(s) 208, 793
BstHHI GCGC 3 cut(s) 183, 498, 574
BstKTI GATC 6 cut(s) 54, 97, 267, 382, 430, 492
BstMBI GATC 6 cut(s) 51, 94, 264, 379, 427, 489
BstMWI GCNNNNNNNGC 6 cut(s) 11, 277, 305, 524, 533, 620
BstNI CCWGG 1 cut(s) 317
BstSCI CCNGG 1 cut(s) 315
BstSFI CTRYAG 1 cut(s) 472
BstV1I GCAGC 3 cut(s) 598, 646, 699
BstX2I RGATCY 2 cut(s) 379, 489
BstYI RGATCY 2 cut(s) 379, 489
BsuRI GGCC 2 cut(s) 373, 518
BtsCI GGATG 2 cut(s) 208, 793
BtsIMutI CAGTG 2 cut(s) 406, 486
Cac8I GCNNGC 2 cut(s) 39, 306
CciI TCATGA 1 cut(s) 91
CfoI GCGC 3 cut(s) 183, 498, 574
Cfr13I GGNCC 2 cut(s) 517, 551
Csp6I GTAC 5 cut(s) 217, 312, 656, 709, 724
CviAII CATG 8 cut(s) 92, 123, 277, 575, 596, 782, 825, 838
CviQI GTAC 5 cut(s) 217, 312, 656, 709, 724
DdeI CTNAG 4 cut(s) 291, 300, 389, 563
DpnI GATC 6 cut(s) 53, 96, 266, 381, 429, 491
DpnII GATC 6 cut(s) 51, 94, 264, 379, 427, 489
DraI TTTAAA 1 cut(s) 154
Eam1104I CTCTTC 3 cut(s) 39, 252, 399
EarI CTCTTC 3 cut(s) 39, 252, 399
Eco130I CCWWGG 3 cut(s) 198, 252, 446
Eco147I AGGCCT 1 cut(s) 373
Eco47I GGWCC 1 cut(s) 551
Eco57I CTGAAG 2 cut(s) 63, 396
EcoO109I RGGNCCY 1 cut(s) 517
EcoRII CCWGG 1 cut(s) 315
EcoT14I CCWWGG 3 cut(s) 198, 252, 446
EcoT22I ATGCAT 2 cut(s) 79, 282
ErhI CCWWGG 3 cut(s) 198, 252, 446
FaeI CATG 8 cut(s) 95, 126, 280, 578, 599, 785, 828, 841
FalI AAGNNNNNCTT 2 cut(s) 324, 356
FatI CATG 8 cut(s) 91, 122, 276, 574, 595, 781, 824, 837
FbaI TGATCA 2 cut(s) 51, 264
FblI GTMKAC 1 cut(s) 702
Fnu4HI GCNGC 4 cut(s) 528, 612, 635, 688
FokI GGATG 2 cut(s) 215, 800
Fsp4HI GCNGC 4 cut(s) 528, 612, 635, 688
FspAI RTGCGCAY 1 cut(s) 573
FspBI CTAG 2 cut(s) 620, 713
FspI TGCGCA 3 cut(s) 182, 497, 573
GlaI GCGC 3 cut(s) 182, 497, 573
GluI GCNGC 4 cut(s) 528, 612, 635, 688
HaeIII GGCC 2 cut(s) 373, 518
HapII CCGG 1 cut(s) 20
HhaI GCGC 3 cut(s) 183, 498, 574
Hin1II CATG 8 cut(s) 95, 126, 280, 578, 599, 785, 828, 841
Hin6I GCGC 3 cut(s) 181, 496, 572
HinP1I GCGC 3 cut(s) 181, 496, 572
HincII GTYRAC 4 cut(s) 175, 233, 288, 777
HindII GTYRAC 4 cut(s) 175, 233, 288, 777
HinfI GANTC 4 cut(s) 211, 602, 778, 846
HpaII CCGG 1 cut(s) 20
HphI GGTGA 1 cut(s) 274
Hpy166II GTNNAC 5 cut(s) 175, 233, 288, 703, 777
Hpy188I TCNGA 4 cut(s) 210, 427, 738, 810
Hpy188III TCNNGA 4 cut(s) 92, 431, 554, 850
Hpy8I GTNNAC 5 cut(s) 175, 233, 288, 703, 777
HpyAV CCTTC 1 cut(s) 572
HpyCH4III ACNGT 2 cut(s) 221, 481
HpyCH4IV ACGT 2 cut(s) 310, 766
HpyCH4V TGCA 6 cut(s) 14, 77, 82, 280, 614, 665
HpyF10VI GCNNNNNNNGC 6 cut(s) 11, 277, 305, 524, 533, 620
HpyF3I CTNAG 4 cut(s) 291, 300, 389, 563
HpySE526I ACGT 2 cut(s) 310, 766
Hsp92II CATG 8 cut(s) 95, 126, 280, 578, 599, 785, 828, 841
HspAI GCGC 3 cut(s) 181, 496, 572
Ksp22I TGATCA 2 cut(s) 51, 264
Kzo9I GATC 6 cut(s) 51, 94, 264, 379, 427, 489
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 8 cut(s) 33, 290, 302, 329, 387, 567, 669, 719
Lsp1109I GCAGC 3 cut(s) 598, 646, 699
LweI GCATC 2 cut(s) 64, 289
MaeI CTAG 2 cut(s) 620, 713
MaeII ACGT 2 cut(s) 310, 766
MaeIII GTNAC 1 cut(s) 439
MalI GATC 6 cut(s) 53, 96, 266, 381, 429, 491
MboI GATC 6 cut(s) 51, 94, 264, 379, 427, 489
MboII GAAGA 5 cut(s) 56, 269, 344, 389, 416
MflI RGATCY 2 cut(s) 379, 489
MluCI AATT 4 cut(s) 7, 144, 558, 752
MlyI GAGTC 2 cut(s) 611, 772
MmeI TCCRAC 1 cut(s) 492
MnlI CCTC 7 cut(s) 253, 363, 365, 508, 535, 541, 729
Mph1103I ATGCAT 2 cut(s) 79, 282
MseI TTAA 1 cut(s) 153
MslI CAYNNNNRTG 2 cut(s) 786, 836
MspI CCGG 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 317
MvaI CCWGG 1 cut(s) 317
MwoI GCNNNNNNNGC 6 cut(s) 11, 277, 305, 524, 533, 620
NdeII GATC 6 cut(s) 51, 94, 264, 379, 427, 489
NlaIII CATG 8 cut(s) 95, 126, 280, 578, 599, 785, 828, 841
NlaIV GGNNCC 1 cut(s) 552
NmeAIII GCCGAG 1 cut(s) 625
NsbI TGCGCA 3 cut(s) 182, 497, 573
NsiI ATGCAT 2 cut(s) 79, 282
PagI TCATGA 1 cut(s) 91
PceI AGGCCT 1 cut(s) 373
PfeI GAWTC 2 cut(s) 211, 846
PkrI GCNGC 4 cut(s) 529, 613, 636, 689
PleI GAGTC 2 cut(s) 610, 772
PpsI GAGTC 2 cut(s) 610, 772
Ppu21I YACGTR 1 cut(s) 311
Psp6I CCWGG 1 cut(s) 315
PspGI CCWGG 1 cut(s) 315
PspN4I GGNNCC 1 cut(s) 552
PspPI GGNCC 2 cut(s) 517, 551
PsuI RGATCY 2 cut(s) 379, 489
RsaI GTAC 5 cut(s) 218, 313, 657, 710, 725
RsaNI GTAC 5 cut(s) 217, 312, 656, 709, 724
RseI CAYNNNNRTG 2 cut(s) 786, 836
SaqAI TTAA 1 cut(s) 153
SatI GCNGC 4 cut(s) 528, 612, 635, 688
Sau3AI GATC 6 cut(s) 51, 94, 264, 379, 427, 489
Sau96I GGNCC 2 cut(s) 517, 551
SchI GAGTC 2 cut(s) 611, 772
ScrFI CCNGG 1 cut(s) 317
SfaNI GCATC 2 cut(s) 64, 289
SfcI CTRYAG 1 cut(s) 472
SinI GGWCC 1 cut(s) 551
SmiMI CAYNNNNRTG 2 cut(s) 786, 836
SmlI CTYRAG 2 cut(s) 321, 485
SmoI CTYRAG 2 cut(s) 321, 485
Sse9I AATT 4 cut(s) 7, 144, 558, 752
SseBI AGGCCT 1 cut(s) 373
SsiI CCGC 1 cut(s) 527
SspMI CTAG 2 cut(s) 620, 713
StuI AGGCCT 1 cut(s) 373
StyD4I CCNGG 1 cut(s) 315
StyI CCWWGG 3 cut(s) 198, 252, 446
TaaI ACNGT 2 cut(s) 221, 481
TaiI ACGT 2 cut(s) 313, 769
TaqI TCGA 1 cut(s) 357
TasI AATT 4 cut(s) 7, 144, 558, 752
TatI WGTACW 1 cut(s) 723
TauI GCSGC 1 cut(s) 530
TfiI GAWTC 2 cut(s) 211, 846
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TscAI CASTG 2 cut(s) 406, 486
TseI GCWGC 3 cut(s) 611, 634, 687
TspDTI ATGAA 4 cut(s) 80, 265, 591, 816
TspRI CASTG 2 cut(s) 406, 486
VpaK11BI GGWCC 1 cut(s) 551
XapI RAATTY 2 cut(s) 7, 558
XmiI GTMKAC 1 cut(s) 702
XspI CTAG 2 cut(s) 620, 713
Zsp2I ATGCAT 2 cut(s) 79, 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.