Rh4BG267100

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
44106418 .. 44106744
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG267100.1

Sequence Viewer

Length: 327 bp
ATGGATGCAGAGTTGATCAATGTTGGGCAGAAGCAAGAGGCATTGAAATCTCTTCATAATGTTATCACCTCAAAGAGGTCTAGAGGATGGCAAAAACCACTTGAAAGGTTTATGTTTAAATATGTAGAGCTTTGCGTTGAGTTGCGCAAGGGTATTTTTGCCAAGGATGGTCTGATTAAGTACCGCAATAGATGTCAACAAGTAAATGATAGCTCCTTGGAAGAGGTCATCAAGCACTTCATGAATCTATCTACTCAGAAAGCTGAGCAGGCTGGTACTCTGGAAGAAGCAGTTAATGTTGATATGATAAGAGTCCCGAAGATATGA

Protein Analysis

108

Amino Acids

12.51

Weight (kDa)

9.2

Isoelectric Point (pI)

28.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3a_PCI_TPR-like PF22591 4 - 97 3.9e-28 eIF3a, PCI domain, TPR-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 146
AciI CCGC 1 cut(s) 184
AfaI GTAC 2 cut(s) 182, 277
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 2 cut(s) 46, 104
AluBI AGCT 3 cut(s) 130, 213, 263
AluI AGCT 3 cut(s) 130, 213, 263
AspLEI GCGC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 58
BccI CCATC 2 cut(s) 81, 161
BclI TGATCA 1 cut(s) 15
BfaI CTAG 1 cut(s) 81
BlpI GCTNAGC 1 cut(s) 264
Bpu1102I GCTNAGC 1 cut(s) 264
BsaJI CCNNGG 2 cut(s) 162, 216
Bsc4I CCNNNNNNNGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 162, 216
BseGI GGATG 3 cut(s) 10, 92, 172
BseLI CCNNNNNNNGG 1 cut(s) 75
BseMII CTCAG 2 cut(s) 255, 269
BslFI GGGAC 1 cut(s) 299
BslI CCNNNNNNNGG 1 cut(s) 75
BsmFI GGGAC 1 cut(s) 299
Bsp143I GATC 1 cut(s) 15
Bsp1720I GCTNAGC 1 cut(s) 264
BspACI CCGC 1 cut(s) 184
BspCNI CTCAG 2 cut(s) 256, 268
BspHI TCATGA 1 cut(s) 240
BssECI CCNNGG 2 cut(s) 162, 216
BssMI GATC 1 cut(s) 15
BssT1I CCWWGG 2 cut(s) 162, 216
Bst6I CTCTTC 2 cut(s) 57, 216
BstC8I GCNNGC 1 cut(s) 270
BstDEI CTNAG 2 cut(s) 255, 264
BstENI CCTNNNNNAGG 1 cut(s) 73
BstF5I GGATG 3 cut(s) 10, 92, 172
BstHHI GCGC 1 cut(s) 147
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 269
BtsCI GGATG 3 cut(s) 10, 92, 172
Cac8I GCNNGC 1 cut(s) 270
CciI TCATGA 1 cut(s) 240
CfoI GCGC 1 cut(s) 147
Csp6I GTAC 2 cut(s) 181, 276
CviAII CATG 1 cut(s) 241
CviJI RGCY 4 cut(s) 130, 213, 263, 272
CviKI_1 RGCY 4 cut(s) 130, 213, 263, 272
CviQI GTAC 2 cut(s) 181, 276
DdeI CTNAG 2 cut(s) 255, 264
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
DraI TTTAAA 1 cut(s) 118
Eam1104I CTCTTC 2 cut(s) 57, 216
EarI CTCTTC 2 cut(s) 57, 216
Eco130I CCWWGG 2 cut(s) 162, 216
EcoNI CCTNNNNNAGG 1 cut(s) 73
EcoT14I CCWWGG 2 cut(s) 162, 216
ErhI CCWWGG 2 cut(s) 162, 216
FaeI CATG 1 cut(s) 244
FaiI YATR 6 cut(s) 57, 113, 123, 242, 305, 325
FaqI GGGAC 1 cut(s) 299
FatI CATG 1 cut(s) 240
FbaI TGATCA 1 cut(s) 15
FokI GGATG 3 cut(s) 17, 99, 179
FspBI CTAG 1 cut(s) 81
FspI TGCGCA 1 cut(s) 146
GlaI GCGC 1 cut(s) 146
HhaI GCGC 1 cut(s) 147
Hin1II CATG 1 cut(s) 244
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HincII GTYRAC 1 cut(s) 197
HindII GTYRAC 1 cut(s) 197
HinfI GANTC 2 cut(s) 244, 312
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 174, 258
Hpy188III TCNNGA 4 cut(s) 81, 241, 281, 316
Hpy8I GTNNAC 1 cut(s) 197
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 1 cut(s) 269
HpyF3I CTNAG 2 cut(s) 255, 264
Hsp92II CATG 1 cut(s) 244
HspAI GCGC 1 cut(s) 145
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 1 cut(s) 15
LmnI GCTCC 1 cut(s) 218
LpnPI CCDG 3 cut(s) 254, 258, 266
MaeI CTAG 1 cut(s) 81
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 3 cut(s) 44, 233, 296
MlyI GAGTC 1 cut(s) 321
MnlI CCTC 5 cut(s) 31, 69, 77, 79, 217
MseI TTAA 3 cut(s) 117, 177, 294
MwoI GCNNNNNNNGC 1 cut(s) 269
NdeII GATC 1 cut(s) 15
NlaIII CATG 1 cut(s) 244
NsbI TGCGCA 1 cut(s) 146
PagI TCATGA 1 cut(s) 240
PfeI GAWTC 1 cut(s) 244
PleI GAGTC 1 cut(s) 320
PpsI GAGTC 1 cut(s) 320
RsaI GTAC 2 cut(s) 182, 277
RsaNI GTAC 2 cut(s) 181, 276
SaqAI TTAA 3 cut(s) 117, 177, 294
Sau3AI GATC 1 cut(s) 15
SchI GAGTC 1 cut(s) 321
SetI ASST 7 cut(s) 71, 80, 110, 132, 215, 228, 265
SsiI CCGC 1 cut(s) 184
SspMI CTAG 1 cut(s) 81
StyI CCWWGG 2 cut(s) 162, 216
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 3 cut(s) 117, 177, 294
Tru9I TTAA 3 cut(s) 117, 177, 294
TspDTI ATGAA 3 cut(s) 44, 229, 257
XagI CCTNNNNNAGG 1 cut(s) 73
XbaI TCTAGA 1 cut(s) 80
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.