Rmu_sc0002045.1_g000025

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002045.1
Physical Location & Seq
Forward (+)
129863 .. 132739
2877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002045.1_g000025.1.cds

Sequence Viewer

Length: 975 bp
atggcgaattttgcgaaaccggataatgctttgaagcgagttgaagagttgatcaattttgggcagaagcaagatgcattgcaatcgcttcatgatcttattacatcaaagagatatagagcatggcagaagccacttgaaaaaattaagttttattatgtggagctttgtgttgacttgcgcaagggtagatttggcaaggatggtcagattcagtaccgtattatatgtcaacaagtaaatgtaagttccttggaagaggtgatcaagcacttcatgcatctgtcaactgagaaagctgagcaggcacgtacccagggtcaagcattagaagaagtacttgatgttgatgacctcgaagcagataagaggcctgaagatctaatgctgacttatgtcagtggagagaaaggaaaagataggaagcatctgcgtaatctgaacaagtatagagatcaaagagaccgacctgacctatctgcacctgagagcttgcaactgtatcttcatactagatttgagcagctgaagatagctactgaacttgaactgtggcaggtgtctgaattctttttgagtatattttttcccccctatgatcagacacgtgctgcctctcacttggaacttgaaaatgagaaagagcgcaatttgaggatgcctaatcgaattggctttaatcgtgaccccaaaatcgacagaggagatgtggtctccaaaggtgtcttcagctgtgcaacccaggaagtaaaggatctcttccatctcctggagcatgaatttctacctctcgaccttgctgtaaagatacaaccactgttgacaaaaatctcaacatttgggggtaagctggcttcaccttcttctgttcctgaagtgcaactgtcacaatatgttcctgcaccaggaaagcttggtactttgaggttgctccagcaggtgtctcgggtgtacatattgcagggttattcctag

Protein Analysis

324

Amino Acids

37.52

Weight (kDa)

7.71

Isoelectric Point (pI)

38.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 547, 928
Acc16I TGCGCA 1 cut(s) 182
Acc36I ACCTGC 2 cut(s) 547, 928
AccB7I CCANNNNNTGG 1 cut(s) 769
AclWI GGATC 1 cut(s) 762
AcsI RAATTY 3 cut(s) 7, 566, 779
AcuI CTGAAG 4 cut(s) 396, 548, 712, 894
AcvI CACGTG 1 cut(s) 608
AfaI GTAC 5 cut(s) 218, 313, 339, 919, 953
AfiI CCNNNNNNNGG 2 cut(s) 769, 905
AflIII ACRYGT 1 cut(s) 605
AgsI TTSAA 5 cut(s) 34, 44, 140, 548, 632
AjnI CCWGG 4 cut(s) 315, 741, 768, 904
AjuI GAANNNNNNNTTGG 2 cut(s) 710, 742
AluBI AGCT 8 cut(s) 166, 299, 492, 526, 536, 732, 850, 913
AluI AGCT 8 cut(s) 166, 299, 492, 526, 536, 732, 850, 913
Alw26I GTCTC 3 cut(s) 456, 718, 948
AlwI GGATC 1 cut(s) 762
Ama87I CYCGRG 1 cut(s) 945
AoxI GGCC 1 cut(s) 371
ApeKI GCWGC 2 cut(s) 523, 611
ApoI RAATTY 3 cut(s) 7, 566, 779
AspLEI GCGC 2 cut(s) 183, 648
AsuHPI GGTGA 2 cut(s) 274, 849
AvaI CYCGRG 1 cut(s) 945
BarI GAAGNNNNNNTAC 2 cut(s) 838, 870
BbrPI CACGTG 1 cut(s) 608
BbsI GAAGAC 1 cut(s) 718
BbvI GCAGC 2 cut(s) 535, 598
BccI CCATC 2 cut(s) 197, 771
BcgI CGANNNNNNTGC 4 cut(s) 66, 100, 926, 960
BciT130I CCWGG 4 cut(s) 317, 743, 770, 906
BclI TGATCA 3 cut(s) 51, 264, 598
BcoDI GTCTC 3 cut(s) 456, 718, 948
BfaI CTAG 2 cut(s) 513, 973
BfuAI ACCTGC 2 cut(s) 547, 928
BglII AGATCT 1 cut(s) 379
BisI GCNGC 2 cut(s) 524, 612
BlpI GCTNAGC 1 cut(s) 300
BlsI GCNGC 2 cut(s) 525, 613
BmcAI AGTACT 1 cut(s) 339
Bme1390I CCNGG 4 cut(s) 317, 743, 770, 906
BmeT110I CYCGRG 1 cut(s) 945
BmrFI CCNGG 4 cut(s) 317, 743, 770, 906
BmsI GCATC 4 cut(s) 64, 289, 436, 648
BoxI GACNNNNGTC 1 cut(s) 395
BpiI GAAGAC 1 cut(s) 718
BpmI CTGGAG 2 cut(s) 791, 917
Bpu1102I GCTNAGC 1 cut(s) 300
BsaAI YACGTR 2 cut(s) 311, 608
BsaI GGTCTC 2 cut(s) 456, 718
BsaJI CCNNGG 4 cut(s) 252, 315, 316, 741
BsaWI WCCGGW 1 cut(s) 19
BsaXI ACNNNNNCTCC 2 cut(s) 696, 726
Bsc4I CCNNNNNNNGG 2 cut(s) 769, 905
Bse3DI GCAATG 1 cut(s) 77
BseBI CCWGG 4 cut(s) 317, 743, 770, 906
BseDI CCNNGG 4 cut(s) 252, 315, 316, 741
BseGI GGATG 2 cut(s) 208, 663
BseLI CCNNNNNNNGG 2 cut(s) 769, 905
BseMI GCAATG 1 cut(s) 77
BseMII CTCAG 3 cut(s) 282, 291, 477
BseRI GAGGAG 1 cut(s) 717
BseXI GCAGC 2 cut(s) 535, 598
BsgI GTGCAG 2 cut(s) 465, 885
BshFI GGCC 1 cut(s) 373
BsiHKCI CYCGRG 1 cut(s) 945
BsiSI CCGG 1 cut(s) 20
BslI CCNNNNNNNGG 2 cut(s) 769, 905
BsmAI GTCTC 3 cut(s) 456, 718, 948
BsnI GGCC 1 cut(s) 373
Bso31I GGTCTC 2 cut(s) 456, 718
BsoBI CYCGRG 1 cut(s) 945
Bsp1407I TGTACA 1 cut(s) 951
Bsp143I GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
Bsp1720I GCTNAGC 1 cut(s) 300
BspANI GGCC 1 cut(s) 373
BspCNI CTCAG 3 cut(s) 283, 292, 478
BspHI TCATGA 1 cut(s) 91
BspMI ACCTGC 2 cut(s) 547, 928
BspPI GGATC 1 cut(s) 762
BspTNI GGTCTC 2 cut(s) 456, 718
BsrDI GCAATG 1 cut(s) 77
BsrGI TGTACA 1 cut(s) 951
BssECI CCNNGG 4 cut(s) 252, 315, 316, 741
BssMI GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
BssT1I CCWWGG 1 cut(s) 252
Bst2UI CCWGG 4 cut(s) 317, 743, 770, 906
Bst4CI ACNGT 5 cut(s) 221, 501, 552, 819, 885
Bst6I CTCTTC 3 cut(s) 39, 252, 764
BstAPI GCANNNNNTGC 1 cut(s) 277
BstAUI TGTACA 1 cut(s) 951
BstBAI YACGTR 2 cut(s) 311, 608
BstC8I GCNNGC 3 cut(s) 306, 494, 852
BstDEI CTNAG 3 cut(s) 291, 300, 486
BstENI CCTNNNNNAGG 1 cut(s) 903
BstF5I GGATG 2 cut(s) 208, 663
BstHHI GCGC 2 cut(s) 183, 648
BstKTI GATC 7 cut(s) 54, 97, 267, 382, 457, 601, 757
BstMAI GTCTC 3 cut(s) 456, 718, 948
BstMBI GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
BstMWI GCNNNNNNNGC 3 cut(s) 11, 277, 305
BstNI CCWGG 4 cut(s) 317, 743, 770, 906
BstPAI GACNNNNGTC 1 cut(s) 395
BstSCI CCNGG 4 cut(s) 315, 741, 768, 904
BstV1I GCAGC 2 cut(s) 535, 598
BstV2I GAAGAC 1 cut(s) 718
BstX2I RGATCY 2 cut(s) 379, 754
BstYI RGATCY 2 cut(s) 379, 754
BsuRI GGCC 1 cut(s) 373
BtsCI GGATG 2 cut(s) 208, 663
BtsIMutI CAGTG 2 cut(s) 406, 815
BveI ACCTGC 2 cut(s) 547, 928
Cac8I GCNNGC 3 cut(s) 306, 494, 852
CciI TCATGA 1 cut(s) 91
CfoI GCGC 2 cut(s) 183, 648
Csp6I GTAC 5 cut(s) 217, 312, 338, 918, 952
CviAII CATG 4 cut(s) 92, 123, 277, 776
CviQI GTAC 5 cut(s) 217, 312, 338, 918, 952
DdeI CTNAG 3 cut(s) 291, 300, 486
DpnI GATC 7 cut(s) 53, 96, 266, 381, 456, 600, 756
DpnII GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
Eam1104I CTCTTC 3 cut(s) 39, 252, 764
EarI CTCTTC 3 cut(s) 39, 252, 764
Eco130I CCWWGG 1 cut(s) 252
Eco147I AGGCCT 1 cut(s) 373
Eco31I GGTCTC 2 cut(s) 456, 718
Eco57I CTGAAG 4 cut(s) 396, 548, 712, 894
Eco72I CACGTG 1 cut(s) 608
Eco88I CYCGRG 1 cut(s) 945
EcoNI CCTNNNNNAGG 1 cut(s) 903
EcoRI GAATTC 1 cut(s) 566
EcoRII CCWGG 4 cut(s) 315, 741, 768, 904
EcoT14I CCWWGG 1 cut(s) 252
EcoT22I ATGCAT 2 cut(s) 79, 282
ErhI CCWWGG 1 cut(s) 252
FaeI CATG 4 cut(s) 95, 126, 280, 779
FalI AAGNNNNNCTT 4 cut(s) 324, 356, 743, 775
FatI CATG 4 cut(s) 91, 122, 276, 775
FbaI TGATCA 3 cut(s) 51, 264, 598
Fnu4HI GCNGC 2 cut(s) 524, 612
FokI GGATG 2 cut(s) 215, 670
Fsp4HI GCNGC 2 cut(s) 524, 612
FspBI CTAG 2 cut(s) 513, 973
FspI TGCGCA 1 cut(s) 182
GlaI GCGC 2 cut(s) 182, 647
GluI GCNGC 2 cut(s) 524, 612
GsuI CTGGAG 2 cut(s) 791, 917
HaeIII GGCC 1 cut(s) 373
HapII CCGG 1 cut(s) 20
HhaI GCGC 2 cut(s) 183, 648
Hin1II CATG 4 cut(s) 95, 126, 280, 779
Hin6I GCGC 2 cut(s) 181, 646
HinP1I GCGC 2 cut(s) 181, 646
HincII GTYRAC 4 cut(s) 175, 233, 288, 822
HindII GTYRAC 4 cut(s) 175, 233, 288, 822
HindIII AAGCTT 1 cut(s) 911
HinfI GANTC 1 cut(s) 211
HpaII CCGG 1 cut(s) 20
HphI GGTGA 2 cut(s) 274, 849
Hpy166II GTNNAC 5 cut(s) 175, 233, 288, 822, 952
Hpy188I TCNGA 4 cut(s) 210, 441, 565, 603
Hpy188III TCNNGA 4 cut(s) 92, 683, 791, 872
Hpy8I GTNNAC 5 cut(s) 175, 233, 288, 822, 952
HpyAV CCTTC 1 cut(s) 870
HpyCH4III ACNGT 5 cut(s) 221, 501, 552, 819, 885
HpyCH4IV ACGT 2 cut(s) 310, 607
HpyCH4V TGCA 9 cut(s) 77, 82, 280, 482, 496, 737, 880, 902, 961
HpyF10VI GCNNNNNNNGC 3 cut(s) 11, 277, 305
HpyF3I CTNAG 3 cut(s) 291, 300, 486
HpySE526I ACGT 2 cut(s) 310, 607
Hsp92II CATG 4 cut(s) 95, 126, 280, 779
HspAI GCGC 2 cut(s) 181, 646
Ksp22I TGATCA 3 cut(s) 51, 264, 598
Kzo9I GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
LmnI GCTCC 3 cut(s) 163, 772, 936
Lsp1109I GCAGC 2 cut(s) 535, 598
LweI GCATC 4 cut(s) 64, 289, 436, 648
MaeI CTAG 2 cut(s) 513, 973
MaeII ACGT 2 cut(s) 310, 607
MaeIII GTNAC 2 cut(s) 683, 885
MalI GATC 7 cut(s) 53, 96, 266, 381, 456, 600, 756
MboI GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
MboII GAAGA 9 cut(s) 56, 269, 344, 389, 497, 541, 718, 751, 855
MflI RGATCY 2 cut(s) 379, 754
MluCI AATT 7 cut(s) 7, 55, 144, 566, 649, 669, 779
MnlI CCTC 8 cut(s) 253, 363, 365, 625, 648, 695, 798, 918
Mph1103I ATGCAT 2 cut(s) 79, 282
MseI TTAA 2 cut(s) 147, 678
MspA1I CMGCKG 2 cut(s) 526, 732
MspI CCGG 1 cut(s) 20
MspR9I CCNGG 4 cut(s) 317, 743, 770, 906
MvaI CCWGG 4 cut(s) 317, 743, 770, 906
MwoI GCNNNNNNNGC 3 cut(s) 11, 277, 305
NdeII GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
NlaIII CATG 4 cut(s) 95, 126, 280, 779
NmuCI GTSAC 2 cut(s) 683, 885
NsbI TGCGCA 1 cut(s) 182
NsiI ATGCAT 2 cut(s) 79, 282
PagI TCATGA 1 cut(s) 91
PaqCI CACCTGC 2 cut(s) 547, 928
PasI CCCWGGG 1 cut(s) 316
PceI AGGCCT 1 cut(s) 373
PfeI GAWTC 1 cut(s) 211
PflMI CCANNNNNTGG 1 cut(s) 769
PfoI TCCNGGA 1 cut(s) 768
PkrI GCNGC 2 cut(s) 525, 613
PmaCI CACGTG 1 cut(s) 608
PmlI CACGTG 1 cut(s) 608
Ppu21I YACGTR 2 cut(s) 311, 608
PshAI GACNNNNGTC 1 cut(s) 395
Psp6I CCWGG 4 cut(s) 315, 741, 768, 904
PspCI CACGTG 1 cut(s) 608
PspGI CCWGG 4 cut(s) 315, 741, 768, 904
PsuI RGATCY 2 cut(s) 379, 754
PvuII CAGCTG 2 cut(s) 526, 732
RsaI GTAC 5 cut(s) 218, 313, 339, 919, 953
RsaNI GTAC 5 cut(s) 217, 312, 338, 918, 952
SaqAI TTAA 2 cut(s) 147, 678
SatI GCNGC 2 cut(s) 524, 612
Sau3AI GATC 7 cut(s) 51, 94, 264, 379, 454, 598, 754
ScaI AGTACT 1 cut(s) 339
ScrFI CCNGG 4 cut(s) 317, 743, 770, 906
SfaNI GCATC 4 cut(s) 64, 289, 436, 648
Sse9I AATT 7 cut(s) 7, 55, 144, 566, 649, 669, 779
SseBI AGGCCT 1 cut(s) 373
SspMI CTAG 2 cut(s) 513, 973
StuI AGGCCT 1 cut(s) 373
StyD4I CCNGG 4 cut(s) 315, 741, 768, 904
StyI CCWWGG 1 cut(s) 252
TaaI ACNGT 5 cut(s) 221, 501, 552, 819, 885
TaiI ACGT 2 cut(s) 313, 610
TaqI TCGA 4 cut(s) 357, 667, 696, 792
TaqII GACCGA 1 cut(s) 480
TasI AATT 7 cut(s) 7, 55, 144, 566, 649, 669, 779
TatI WGTACW 2 cut(s) 337, 951
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 2 cut(s) 147, 678
Tru9I TTAA 2 cut(s) 147, 678
TscAI CASTG 2 cut(s) 406, 822
TseFI GTSAC 2 cut(s) 683, 885
TseI GCWGC 2 cut(s) 523, 611
Tsp45I GTSAC 2 cut(s) 683, 885
TspDTI ATGAA 4 cut(s) 80, 265, 497, 792
TspRI CASTG 2 cut(s) 406, 822
Van91I CCANNNNNTGG 1 cut(s) 769
XagI CCTNNNNNAGG 1 cut(s) 903
XapI RAATTY 3 cut(s) 7, 566, 779
XspI CTAG 2 cut(s) 513, 973
ZrmI AGTACT 1 cut(s) 339
Zsp2I ATGCAT 2 cut(s) 79, 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.