Rh4DG263400

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
48186695 .. 48187024
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG263400.1

Sequence Viewer

Length: 330 bp
ATGAGATCTATCTGCTATAGGAGTCTTATTGAAATCCTTGATTTACAGATGACAGCAAATCGAGCCTTCCAGTTCTGCAAGAAATACAAACGAACAACAGAGTTTCGCAGGTTATGTGGAACCATCAGAAATCATTTGGCAAATCTGAACAAAAATAAAGATCAAAGAAACCAGGCTGGCCTATCTTCACCTGAGAGCTTACAACTCTATCTTGATACAAGATTACACCAGCTGAAGACAGCTACTAAACTTGAACCGTGGCAGGAAGCATTTCCTTGTATTGAAGATATTCATAGATTGATGTGCATGGTTAAGAAAGAAAACCCCTAA

Protein Analysis

109

Amino Acids

12.94

Weight (kDa)

9.54

Isoelectric Point (pI)

63.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3a_PCI_TPR-like PF22591 16 - 107 3.2e-35 eIF3a, PCI domain, TPR-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 99
AcuI CTGAAG 1 cut(s) 254
AgsI TTSAA 3 cut(s) 32, 254, 284
AjnI CCWGG 1 cut(s) 171
AluBI AGCT 3 cut(s) 198, 232, 242
AluI AGCT 3 cut(s) 198, 232, 242
AoxI GGCC 1 cut(s) 178
Asp700I GAANNNNTTC 2 cut(s) 270, 288
AsuHPI GGTGA 1 cut(s) 180
BbsI GAAGAC 1 cut(s) 242
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 173
BfmI CTRYAG 1 cut(s) 16
BfuAI ACCTGC 1 cut(s) 99
BglII AGATCT 1 cut(s) 5
Bme1390I CCNGG 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 173
BpiI GAAGAC 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 257
Bse1I ACTGG 1 cut(s) 70
BseBI CCWGG 1 cut(s) 173
BseDI CCNNGG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 70
BshFI GGCC 1 cut(s) 180
BsnI GGCC 1 cut(s) 180
Bsp143I GATC 2 cut(s) 5, 160
BspANI GGCC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 121
BspMI ACCTGC 1 cut(s) 99
BsrI ACTGG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 257
BssMI GATC 2 cut(s) 5, 160
Bst2UI CCWGG 1 cut(s) 173
Bst4CI ACNGT 1 cut(s) 258
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 192
BstDSI CCRYGG 1 cut(s) 257
BstKTI GATC 2 cut(s) 8, 163
BstMBI GATC 2 cut(s) 5, 160
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BstSFI CTRYAG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
BsuRI GGCC 1 cut(s) 180
BtgI CCRYGG 1 cut(s) 257
BveI ACCTGC 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 178
CviAII CATG 1 cut(s) 307
CviJI RGCY 6 cut(s) 65, 176, 180, 198, 232, 242
CviKI_1 RGCY 6 cut(s) 65, 176, 180, 198, 232, 242
DdeI CTNAG 1 cut(s) 192
DpnI GATC 2 cut(s) 7, 162
DpnII GATC 2 cut(s) 5, 160
Eco57I CTGAAG 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 171
FaeI CATG 1 cut(s) 310
FaiI YATR 4 cut(s) 18, 115, 294, 308
FatI CATG 1 cut(s) 306
HaeIII GGCC 1 cut(s) 180
Hin1II CATG 1 cut(s) 310
HinfI GANTC 1 cut(s) 22
HphI GGTGA 1 cut(s) 180
Hpy188I TCNGA 2 cut(s) 128, 147
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 258
HpyCH4V TGCA 2 cut(s) 78, 306
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 192
Hsp92II CATG 1 cut(s) 310
Kzo9I GATC 2 cut(s) 5, 160
LpnPI CCDG 8 cut(s) 83, 94, 158, 162, 185, 204, 242, 248
MalI GATC 2 cut(s) 7, 162
MboI GATC 2 cut(s) 5, 160
MboII GAAGA 3 cut(s) 177, 247, 296
MflI RGATCY 1 cut(s) 5
MlyI GAGTC 1 cut(s) 31
MroXI GAANNNNTTC 2 cut(s) 270, 288
MseI TTAA 1 cut(s) 312
MspA1I CMGCKG 1 cut(s) 232
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
MwoI GCNNNNNNNGC 1 cut(s) 62
NdeII GATC 2 cut(s) 5, 160
NlaIII CATG 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 121
PdmI GAANNNNTTC 2 cut(s) 270, 288
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 121
PsuI RGATCY 1 cut(s) 5
PvuII CAGCTG 1 cut(s) 232
SaqAI TTAA 1 cut(s) 312
Sau3AI GATC 2 cut(s) 5, 160
SchI GAGTC 1 cut(s) 31
ScrFI CCNGG 1 cut(s) 173
SetI ASST 5 cut(s) 113, 193, 200, 234, 244
SfcI CTRYAG 1 cut(s) 16
StyD4I CCNGG 1 cut(s) 171
TaaI ACNGT 1 cut(s) 258
TaqI TCGA 1 cut(s) 61
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TspDTI ATGAA 1 cut(s) 281
XmnI GAANNNNTTC 2 cut(s) 270, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.