Rh4AG261300

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
57734533 .. 57735108
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG261300.1

Sequence Viewer

Length: 363 bp
ATGGCGAATTTTGTGAATCCCGAGAATGCGTTGAAGCGAGCAGAAGAGTTGATCAATGTTGGGCAGAAGCAAGAGGCATTGAAATCTCTTCATAATGTTATCACCTCAAAGAGGTCTAGAGGATGGCAAAAACCACTTGAAAGGTTTATGTTTAAATATGTAGAGCTTTGCGTTGAGTTGCGCAAGGGTATTTTTGCCAAGGATGGTCTGATTAAGTACCGCAATAGATGTCAACAAGTAAATGATAGCTCCTTGGAAGAGGTCATCAAGCACTTCATGAATCTATCTACTCAGAAAGCTGAGCAGGCTGGTACTCTGGAAGAAGCAGTTAATGTTGATATGATAAGAGTCCCGAAGATATGA

Protein Analysis

120

Amino Acids

13.88

Weight (kDa)

9.36

Isoelectric Point (pI)

31.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3a_PCI_TPR-like PF22591 8 - 109 1.8e-33 eIF3a, PCI domain, TPR-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 182
AciI CCGC 1 cut(s) 220
AcsI RAATTY 1 cut(s) 7
AfaI GTAC 2 cut(s) 218, 313
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 3 cut(s) 34, 82, 140
AluBI AGCT 3 cut(s) 166, 249, 299
AluI AGCT 3 cut(s) 166, 249, 299
Ama87I CYCGRG 1 cut(s) 20
ApoI RAATTY 1 cut(s) 7
AspLEI GCGC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 94
AvaI CYCGRG 1 cut(s) 20
BccI CCATC 2 cut(s) 117, 197
BclI TGATCA 1 cut(s) 51
BfaI CTAG 1 cut(s) 117
BlpI GCTNAGC 1 cut(s) 300
BmeT110I CYCGRG 1 cut(s) 20
Bpu1102I GCTNAGC 1 cut(s) 300
BsaJI CCNNGG 2 cut(s) 198, 252
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseDI CCNNGG 2 cut(s) 198, 252
BseGI GGATG 2 cut(s) 128, 208
BseLI CCNNNNNNNGG 1 cut(s) 111
BseMII CTCAG 2 cut(s) 291, 305
BsiHKCI CYCGRG 1 cut(s) 20
BslFI GGGAC 1 cut(s) 335
BslI CCNNNNNNNGG 1 cut(s) 111
BsmFI GGGAC 1 cut(s) 335
BsmI GAATGC 1 cut(s) 31
BsoBI CYCGRG 1 cut(s) 20
Bsp143I GATC 1 cut(s) 51
Bsp1720I GCTNAGC 1 cut(s) 300
BspACI CCGC 1 cut(s) 220
BspCNI CTCAG 2 cut(s) 292, 304
BspHI TCATGA 1 cut(s) 276
BssECI CCNNGG 2 cut(s) 198, 252
BssMI GATC 1 cut(s) 51
BssT1I CCWWGG 2 cut(s) 198, 252
Bst6I CTCTTC 3 cut(s) 39, 93, 252
BstC8I GCNNGC 2 cut(s) 39, 306
BstDEI CTNAG 2 cut(s) 291, 300
BstENI CCTNNNNNAGG 1 cut(s) 109
BstF5I GGATG 2 cut(s) 128, 208
BstHHI GCGC 1 cut(s) 183
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 305
BtsCI GGATG 2 cut(s) 128, 208
Cac8I GCNNGC 2 cut(s) 39, 306
CciI TCATGA 1 cut(s) 276
CfoI GCGC 1 cut(s) 183
Csp6I GTAC 2 cut(s) 217, 312
CviAII CATG 1 cut(s) 277
CviJI RGCY 4 cut(s) 166, 249, 299, 308
CviKI_1 RGCY 4 cut(s) 166, 249, 299, 308
CviQI GTAC 2 cut(s) 217, 312
DdeI CTNAG 2 cut(s) 291, 300
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
DraI TTTAAA 1 cut(s) 154
Eam1104I CTCTTC 3 cut(s) 39, 93, 252
EarI CTCTTC 3 cut(s) 39, 93, 252
Eco130I CCWWGG 2 cut(s) 198, 252
Eco88I CYCGRG 1 cut(s) 20
EcoNI CCTNNNNNAGG 1 cut(s) 109
EcoT14I CCWWGG 2 cut(s) 198, 252
ErhI CCWWGG 2 cut(s) 198, 252
FaeI CATG 1 cut(s) 280
FaiI YATR 6 cut(s) 93, 149, 159, 278, 341, 361
FaqI GGGAC 1 cut(s) 335
FatI CATG 1 cut(s) 276
FbaI TGATCA 1 cut(s) 51
FokI GGATG 2 cut(s) 135, 215
FspBI CTAG 1 cut(s) 117
FspI TGCGCA 1 cut(s) 182
GlaI GCGC 1 cut(s) 182
HhaI GCGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 280
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
HincII GTYRAC 1 cut(s) 233
HindII GTYRAC 1 cut(s) 233
HinfI GANTC 3 cut(s) 16, 280, 348
HphI GGTGA 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 2 cut(s) 210, 294
Hpy188III TCNNGA 5 cut(s) 20, 117, 277, 317, 352
Hpy8I GTNNAC 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 305
HpyF3I CTNAG 2 cut(s) 291, 300
Hsp92II CATG 1 cut(s) 280
HspAI GCGC 1 cut(s) 181
Ksp22I TGATCA 1 cut(s) 51
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 254
LpnPI CCDG 3 cut(s) 290, 294, 302
MaeI CTAG 1 cut(s) 117
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 4 cut(s) 56, 80, 269, 332
MluCI AATT 1 cut(s) 7
MlyI GAGTC 1 cut(s) 357
MnlI CCTC 5 cut(s) 67, 105, 113, 115, 253
MseI TTAA 3 cut(s) 153, 213, 330
Mva1269I GAATGC 1 cut(s) 31
MwoI GCNNNNNNNGC 1 cut(s) 305
NdeII GATC 1 cut(s) 51
NlaIII CATG 1 cut(s) 280
NsbI TGCGCA 1 cut(s) 182
PagI TCATGA 1 cut(s) 276
PctI GAATGC 1 cut(s) 31
PfeI GAWTC 2 cut(s) 16, 280
PleI GAGTC 1 cut(s) 356
PpsI GAGTC 1 cut(s) 356
RsaI GTAC 2 cut(s) 218, 313
RsaNI GTAC 2 cut(s) 217, 312
SaqAI TTAA 3 cut(s) 153, 213, 330
Sau3AI GATC 1 cut(s) 51
SchI GAGTC 1 cut(s) 357
SetI ASST 7 cut(s) 107, 116, 146, 168, 251, 264, 301
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 220
SspMI CTAG 1 cut(s) 117
StyI CCWWGG 2 cut(s) 198, 252
TasI AATT 1 cut(s) 7
TfiI GAWTC 2 cut(s) 16, 280
Tru1I TTAA 3 cut(s) 153, 213, 330
Tru9I TTAA 3 cut(s) 153, 213, 330
TspDTI ATGAA 3 cut(s) 80, 265, 293
XagI CCTNNNNNAGG 1 cut(s) 109
XapI RAATTY 1 cut(s) 7
XbaI TCTAGA 1 cut(s) 116
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.