Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000373.1

Orthogroup ID

OG0000479

Physical Location & Seq

Genomic Coordinates Forward (+)

68582 .. 68947

Gene Structure 366 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000373.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

atggcttttcttgtaggctgtcttcttgcctttgcagttatcctgaatgctgaagcaaaagcggtgccatctaatataagcaccgactcttctttaacacccacttccaactcctcgtggttgtcaagctccggtctgtatgccttcggcttttatgagcaaggcaatggctatgctgtggggatagtgcttgctggagttcctgaaaagactgtagtctggactgcaaaccgcaatgaccccttggtctccaataatgccaccttgctctttacatctaaagggctttcgttgcaatcgactcaaggggaaacacctgtggcgaccactactcagtctgctttctccgcttcaatgcttgactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

121

Amino Acids

12.56

Weight (kDa)

4.55

Isoelectric Point (pI)

43.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000479)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g23370 FvH4_1g23380
malus_domestica	MD15G1391000.v1.1 MD15G1391100.v1.1
prunus_persica	Prupe.6G158300_v2.0.a1 Prupe.6G158400_v2.0.a1 Prupe.6G158700_v2.0.a1 Prupe.6G158900_v2.0.a1 Prupe.6G159000_v2.0.a1 Prupe.6G164400_v2.0.a1 Prupe.6G164900_v2.0.a1
pyrus_communis	pycom15g35040 pycom15g35130 pycom15g35150
rosa_chinensis	RchiOBHm_Chr2g0118321 RchiOBHm_Chr2g0118331 RchiOBHm_Chr2g0118351 RchiOBHm_Chr2g0118361 RchiOBHm_Chr2g0118371 RchiOBHm_Chr2g0118591 RchiOBHm_Chr2g0118601 RchiOBHm_Chr2g0118631 RchiOBHm_Chr2g0118641 RchiOBHm_Chr2g0118651
rosa_laevigata	RLG00000018409 RLG00000018410 RLG00000018411 RLG00000018412 RLG00000018413 RLG00000018414
rosa_multiflora	Rmu_co8003212.1_g000001 Rmu_co8379303.1_g000001 Rmu_co8418889.1_g000001 Rmu_sc0000373.1_g000002 Rmu_sc0000373.1_g000006 Rmu_sc0000373.1_g000013 Rmu_sc0000373.1_g000014 Rmu_sc0000373.1_g000015 Rmu_sc0000373.1_g000017 Rmu_sc0000373.1_g000018 Rmu_sc0008015.1_g000001 Rmu_sc0016207.1_g000001 Rmu_sc0017451.1_g000001
rosa_roxburghii	Rroxscaffold_2G00124920 Rroxscaffold_2G00124930 Rroxscaffold_2G00124940 Rroxscaffold_2G00124960 Rroxscaffold_2G00124970 Rroxscaffold_2G00124990 Rroxscaffold_2G00125010 Rroxscaffold_2G00125600 Rroxscaffold_2G00125610 Rroxscaffold_2G00125640 Rroxscaffold_2G00125650 Rroxscaffold_2G00125670 Rroxscaffold_2G00125680
rosa_rugosa	Rorug02G0217500 Rorug02G0217600 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217800
rosa_samantha	Rh2AG273800 Rh2AG273900 Rh2AG274200 Rh2AG274300 Rh2BG285900 Rh2BG286000 Rh2BG286200 Rh2BG286300 Rh2BG286400 Rh2DG281700 Rh2DG281800 Rh2DG281900 Rh2DG282000 Rh2DG299900 Rh2DG300000 Rh2DG300100 Rh2DG300300 Rh2DG300600 Rh2DG300800 Rh2DG301200 Rh2DG301300
rosa_wichuraiana	Rw2G021790 Rw2G021800 Rw2G021810 Rw2G021820 Rw2G021830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	245
AccB1I	GGYRCC	1 cut(s)	64
AciI	CCGC	3 cut(s)	62, 232, 348
AcuI	CTGAAG	1 cut(s)	72
AgsI	TTSAA	1 cut(s)	354
AluBI	AGCT	1 cut(s)	129
AluI	AGCT	1 cut(s)	129
Alw26I	GTCTC	1 cut(s)	253
BanI	GGYRCC	1 cut(s)	64
BarI	GAAGNNNNNNTAC	1 cut(s)	38
BauI	CACGAG	1 cut(s)	115
BbsI	GAAGAC	1 cut(s)	14
BccI	CCATC	1 cut(s)	76
BcoDI	GTCTC	1 cut(s)	253
BfaI	CTAG	1 cut(s)	364
BfmI	CTRYAG	1 cut(s)	213
BmiI	GGNNCC	1 cut(s)	66
BoxI	GACNNNNGTC	1 cut(s)	215
BpiI	GAAGAC	1 cut(s)	14
BpmI	CTGGAG	1 cut(s)	216
BpuEI	CTTGAG	1 cut(s)	288
BsaI	GGTCTC	1 cut(s)	253
BsaJI	CCNNGG	1 cut(s)	243
BsaWI	WCCGGW	1 cut(s)	131
Bse3DI	GCAATG	2 cut(s)	172, 241
BseDI	CCNNGG	1 cut(s)	243
BseMI	GCAATG	2 cut(s)	172, 241
BseMII	CTCAG	1 cut(s)	347
BseRI	GAGGAG	1 cut(s)	103
BshNI	GGYRCC	1 cut(s)	64
BsiSI	CCGG	1 cut(s)	132
BsmAI	GTCTC	1 cut(s)	253
BsmI	GAATGC	1 cut(s)	52
Bso31I	GGTCTC	1 cut(s)	253
BspACI	CCGC	3 cut(s)	62, 232, 348
BspCNI	CTCAG	1 cut(s)	346
BspLI	GGNNCC	1 cut(s)	66
BspT107I	GGYRCC	1 cut(s)	64
BspTNI	GGTCTC	1 cut(s)	253
BsrDI	GCAATG	2 cut(s)	172, 241
BssECI	CCNNGG	1 cut(s)	243
BssSI	CACGAG	1 cut(s)	115
BssT1I	CCWWGG	1 cut(s)	243
Bst2BI	CACGAG	1 cut(s)	115
Bst4CI	ACNGT	1 cut(s)	214
Bst6I	CTCTTC	1 cut(s)	94
BstC8I	GCNNGC	1 cut(s)	192
BstDEI	CTNAG	1 cut(s)	333
BstMAI	GTCTC	1 cut(s)	253
BstMWI	GCNNNNNNNGC	2 cut(s)	292, 347
BstPAI	GACNNNNGTC	1 cut(s)	215
BstSFI	CTRYAG	1 cut(s)	213
BstV2I	GAAGAC	1 cut(s)	14
Cac8I	GCNNGC	1 cut(s)	192
CviJI	RGCY	6 cut(s)	5, 18, 129, 150, 171, 286
CviKI_1	RGCY	6 cut(s)	5, 18, 129, 150, 171, 286
DdeI	CTNAG	1 cut(s)	333
DrdI	GACNNNNNNGTC	1 cut(s)	245
DseDI	GACNNNNNNGTC	1 cut(s)	245
Eam1104I	CTCTTC	1 cut(s)	94
EarI	CTCTTC	1 cut(s)	94
Eco130I	CCWWGG	1 cut(s)	243
Eco31I	GGTCTC	1 cut(s)	253
Eco57I	CTGAAG	1 cut(s)	72
EcoT14I	CCWWGG	1 cut(s)	243
ErhI	CCWWGG	1 cut(s)	243
FaiI	YATR	4 cut(s)	77, 141, 156, 174
FspBI	CTAG	1 cut(s)	364
GsuI	CTGGAG	1 cut(s)	216
HapII	CCGG	1 cut(s)	132
HinfI	GANTC	2 cut(s)	86, 301
HpaII	CCGG	1 cut(s)	132
Hpy188III	TCNNGA	3 cut(s)	43, 203, 220
HpyAV	CCTTC	1 cut(s)	154
HpyCH4III	ACNGT	1 cut(s)	214
HpyCH4V	TGCA	3 cut(s)	35, 227, 295
HpyF10VI	GCNNNNNNNGC	2 cut(s)	292, 347
HpyF3I	CTNAG	1 cut(s)	333
LmnI	GCTCC	1 cut(s)	134
LpnPI	CCDG	6 cut(s)	56, 145, 180, 205, 216, 330
MaeI	CTAG	1 cut(s)	364
MboII	GAAGA	2 cut(s)	14, 81
MlyI	GAGTC	2 cut(s)	80, 295
MmeI	TCCRAC	1 cut(s)	132
MnlI	CCTC	1 cut(s)	124
MseI	TTAA	1 cut(s)	95
MspI	CCGG	1 cut(s)	132
Mva1269I	GAATGC	1 cut(s)	52
MwoI	GCNNNNNNNGC	2 cut(s)	292, 347
NlaIV	GGNNCC	1 cut(s)	66
PcsI	WCGNNNNNNNCGW	1 cut(s)	296
PctI	GAATGC	1 cut(s)	52
PleI	GAGTC	2 cut(s)	80, 295
PpsI	GAGTC	2 cut(s)	80, 295
PshAI	GACNNNNGTC	1 cut(s)	215
PspN4I	GGNNCC	1 cut(s)	66
SaqAI	TTAA	1 cut(s)	95
SchI	GAGTC	2 cut(s)	80, 295
SetI	ASST	3 cut(s)	131, 266, 319
SfcI	CTRYAG	1 cut(s)	213
SmlI	CTYRAG	1 cut(s)	303
SmoI	CTYRAG	1 cut(s)	303
SsiI	CCGC	3 cut(s)	62, 232, 348
SspMI	CTAG	1 cut(s)	364
StyI	CCWWGG	1 cut(s)	243
TaaI	ACNGT	1 cut(s)	214
TaqI	TCGA	1 cut(s)	299
Tru1I	TTAA	1 cut(s)	95
Tru9I	TTAA	1 cut(s)	95
XspI	CTAG	1 cut(s)	364

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.