Rmu_sc0016207.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016207.1
Physical Location & Seq
Reverse (-)
2 .. 1535
1534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016207.1_g000001.1.cds

Sequence Viewer

Length: 1534 bp
atgccactttgctctttacatctaacgggagtgcttgctggagttcctgaaaagactgtagtctggactgcaaaccgcaatgaccccttggtctccaataatgccaccttgcactttacatctaacgggctttcgttgcaatcgactcaaggggaaacacctgtggcgaccactactcagtctgctttctctgcttcaatgcttgactctggtaactttgtactatacaactccgatcaggaaatagtatggcaaagttttgactatccaactgataccattttgccaaaacagcgtttgaaagcaggggcagagctgtactctgctaaatccaaaactaatagatcaaaaggcattttccgtctcagtatgcagactgatggaaaccttgttcagtacccggtagctactctggatgcttactatgcatctaacacgccaggaagtggagacaatgtgacactaaacttggatgctgatggccatctctacttactcaacaacactggtttcactatacacaatattacgaatggatctactgatgaaggcaaatcttatcttgtgagacttgatgtagatggaattcttcgcttgtattcgtatagtttgaagcagaatggcaactggtcagttgagtggttatctacaagagataagtgtgaccctttaggtctatgcggatttaatagttattgtgttttaatggatatggaagctgaatgcaaatgccttccaggatttgagtttatcacctcgggggatcagacttcaggctgtgggaggaatatgattgcagatgtttgtaagtcagagaatgaaaacttcacatacatcatggaagaactgcccgacacaagatggaataatgttgcatacatgacttggtcatcatcagacaaagaagaatgcaacaaggcctgcttggaggattgcaactgtgaagccgcacttttcgcagatggaagctgcagaaagcagaggcttcctttgagtcatggaagaagaaggtatgacacttcaaactcagttttcattaaggttggtaaatctaaacctccagctacagataatatccattcaaagggaaacaagaaagaaggtggagttgcagtccttattgttggggtttcatttactgcttttgggtccattttgttggtgatctctgtaattgtgttttggaaacataatgtttgggcttataaaaggatgaataaactcaatggtgatgttgaatggaatgaggatgtggctcctcgaccatatacttatgaacaactagagaagatgactgataatttcaaggaggaggtcggtagaggagcttccgcaacagtttataaaggggtgatgttgagtagtcaaaagctagttgctgtgaagaaactagagaaagttgcagctgaaggagcaaaagaattccagactgagatgaaagttattggcaaaagccatcaccggagtttagtacgtttgcttgggtattgccttgatggaccaaagaagcttttggtgtatgagtacatgagca

Protein Analysis

511

Amino Acids

56.71

Weight (kDa)

6.34

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000479)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g23370 FvH4_1g23380
malus_domestica MD15G1391000.v1.1 MD15G1391100.v1.1
prunus_persica Prupe.6G158300_v2.0.a1 Prupe.6G158400_v2.0.a1 Prupe.6G158700_v2.0.a1 Prupe.6G158900_v2.0.a1 Prupe.6G159000_v2.0.a1 Prupe.6G164400_v2.0.a1 Prupe.6G164900_v2.0.a1
pyrus_communis pycom15g35040 pycom15g35130 pycom15g35150
rosa_chinensis RchiOBHm_Chr2g0118321 RchiOBHm_Chr2g0118331 RchiOBHm_Chr2g0118351 RchiOBHm_Chr2g0118361 RchiOBHm_Chr2g0118371 RchiOBHm_Chr2g0118591 RchiOBHm_Chr2g0118601 RchiOBHm_Chr2g0118631 RchiOBHm_Chr2g0118641 RchiOBHm_Chr2g0118651
rosa_laevigata RLG00000018409 RLG00000018410 RLG00000018411 RLG00000018412 RLG00000018413 RLG00000018414
rosa_multiflora Rmu_co8003212.1_g000001 Rmu_co8379303.1_g000001 Rmu_co8418889.1_g000001 Rmu_sc0000373.1_g000002 Rmu_sc0000373.1_g000006 Rmu_sc0000373.1_g000013 Rmu_sc0000373.1_g000014 Rmu_sc0000373.1_g000015 Rmu_sc0000373.1_g000017 Rmu_sc0000373.1_g000018 Rmu_sc0008015.1_g000001 Rmu_sc0016207.1_g000001 Rmu_sc0017451.1_g000001
rosa_roxburghii Rroxscaffold_2G00124920 Rroxscaffold_2G00124930 Rroxscaffold_2G00124940 Rroxscaffold_2G00124960 Rroxscaffold_2G00124970 Rroxscaffold_2G00124990 Rroxscaffold_2G00125010 Rroxscaffold_2G00125600 Rroxscaffold_2G00125610 Rroxscaffold_2G00125640 Rroxscaffold_2G00125650 Rroxscaffold_2G00125670 Rroxscaffold_2G00125680
rosa_rugosa Rorug02G0217500 Rorug02G0217600 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217700 Rorug02G0217800
rosa_samantha Rh2AG273800 Rh2AG273900 Rh2AG274200 Rh2AG274300 Rh2BG285900 Rh2BG286000 Rh2BG286200 Rh2BG286300 Rh2BG286400 Rh2DG281700 Rh2DG281800 Rh2DG281900 Rh2DG282000 Rh2DG299900 Rh2DG300000 Rh2DG300100 Rh2DG300300 Rh2DG300600 Rh2DG300800 Rh2DG301200 Rh2DG301300
rosa_wichuraiana Rw2G021790 Rw2G021800 Rw2G021810 Rw2G021820 Rw2G021830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1206, 1344
AasI GACNNNNNNGTC 1 cut(s) 89
AccB7I CCANNNNNTGG 1 cut(s) 446
AciI CCGC 4 cut(s) 76, 681, 948, 1332
AclWI GGATC 2 cut(s) 544, 771
AcoI YGGCCR 1 cut(s) 481
AcsI RAATTY 2 cut(s) 585, 1421
AcuI CTGAAG 2 cut(s) 756, 1428
AfaI GTAC 5 cut(s) 222, 320, 398, 1473, 1526
AfiI CCNNNNNNNGG 2 cut(s) 446, 1084
AgsI TTSAA 7 cut(s) 198, 301, 613, 1023, 1083, 1238, 1306
AjnI CCWGG 2 cut(s) 439, 736
AloI GAACNNNNNNTCC 2 cut(s) 375, 407
AluBI AGCT 9 cut(s) 316, 407, 719, 969, 1064, 1328, 1372, 1406, 1510
AluI AGCT 9 cut(s) 316, 407, 719, 969, 1064, 1328, 1372, 1406, 1510
Alw26I GTCTC 4 cut(s) 97, 368, 444, 562
AlwI GGATC 2 cut(s) 544, 771
Ama87I CYCGRG 1 cut(s) 757
AoxI GGCC 2 cut(s) 481, 918
ApeKI GCWGC 2 cut(s) 969, 1403
ApoI RAATTY 2 cut(s) 585, 1421
AspS9I GGNCC 2 cut(s) 1149, 1499
AsuC2I CCSGG 1 cut(s) 401
AsuHPI GGTGA 5 cut(s) 745, 1174, 1241, 1363, 1451
AvaI CYCGRG 1 cut(s) 757
AvaII GGWCC 2 cut(s) 1149, 1499
BalI TGGCCA 1 cut(s) 483
BarI GAAGNNNNNNTAC 2 cut(s) 1312, 1344
BbvI GCAGC 2 cut(s) 956, 1415
BccI CCATC 8 cut(s) 374, 473, 492, 575, 855, 956, 1464, 1490
BciT130I CCWGG 2 cut(s) 441, 738
BcnI CCSGG 1 cut(s) 401
BcoDI GTCTC 4 cut(s) 97, 368, 444, 562
BfaI CTAG 3 cut(s) 1283, 1373, 1391
BfmI CTRYAG 3 cut(s) 57, 970, 1065
BisI GCNGC 3 cut(s) 948, 970, 1404
BlsI GCNGC 3 cut(s) 949, 971, 1405
Bme1390I CCNGG 3 cut(s) 401, 441, 738
Bme18I GGWCC 2 cut(s) 1149, 1499
BmeT110I CYCGRG 1 cut(s) 757
BmgT120I GGNCC 2 cut(s) 1149, 1499
BmiI GGNNCC 2 cut(s) 1150, 1257
BmrFI CCNGG 3 cut(s) 401, 441, 738
BmsI GCATC 3 cut(s) 406, 437, 463
BoxI GACNNNNGTC 1 cut(s) 59
BplI GAGNNNNNCTC 2 cut(s) 305, 337
BpmI CTGGAG 2 cut(s) 60, 1044
BpuEI CTTGAG 1 cut(s) 132
BpuMI CCSGG 1 cut(s) 401
BsaBI GATNNNNATC 1 cut(s) 483
BsaI GGTCTC 1 cut(s) 97
BsaJI CCNNGG 2 cut(s) 87, 756
BsaWI WCCGGW 1 cut(s) 1461
BsaXI ACNNNNNCTCC 4 cut(s) 441, 471, 1098, 1128
Bsc4I CCNNNNNNNGG 2 cut(s) 446, 1084
Bse1I ACTGG 2 cut(s) 511, 632
Bse3DI GCAATG 1 cut(s) 85
Bse8I GATNNNNATC 1 cut(s) 483
BseBI CCWGG 2 cut(s) 441, 738
BseDI CCNNGG 2 cut(s) 87, 756
BseGI GGATG 4 cut(s) 421, 478, 1218, 1255
BseJI GATNNNNATC 1 cut(s) 483
BseLI CCNNNNNNNGG 2 cut(s) 446, 1084
BseMI GCAATG 1 cut(s) 85
BseMII CTCAG 4 cut(s) 191, 379, 1041, 1422
BseNI ACTGG 2 cut(s) 511, 632
BseRI GAGGAG 3 cut(s) 1248, 1325, 1338
BseXI GCAGC 2 cut(s) 956, 1415
BshFI GGCC 2 cut(s) 483, 920
BsiHKCI CYCGRG 1 cut(s) 757
BsiSI CCGG 2 cut(s) 401, 1462
BslI CCNNNNNNNGG 2 cut(s) 446, 1084
BsmAI GTCTC 4 cut(s) 97, 368, 444, 562
BsmBI CGTCTC 1 cut(s) 368
BsmI GAATGC 2 cut(s) 728, 914
BsnI GGCC 2 cut(s) 483, 920
Bso31I GGTCTC 1 cut(s) 97
BsoBI CYCGRG 1 cut(s) 757
Bsp143I GATC 5 cut(s) 235, 344, 536, 763, 1164
BspACI CCGC 4 cut(s) 76, 681, 948, 1332
BspANI GGCC 2 cut(s) 483, 920
BspCNI CTCAG 4 cut(s) 190, 378, 1040, 1423
BspLI GGNNCC 2 cut(s) 1150, 1257
BspMAI CTGCAG 1 cut(s) 974
BspPI GGATC 2 cut(s) 544, 771
BspTNI GGTCTC 1 cut(s) 97
BsrDI GCAATG 1 cut(s) 85
BsrI ACTGG 2 cut(s) 511, 632
BssECI CCNNGG 2 cut(s) 87, 756
BssMI GATC 5 cut(s) 235, 344, 536, 763, 1164
BssT1I CCWWGG 1 cut(s) 87
Bst2UI CCWGG 2 cut(s) 441, 738
Bst4CI ACNGT 3 cut(s) 58, 941, 1339
BstC8I GCNNGC 2 cut(s) 36, 922
BstDEI CTNAG 4 cut(s) 177, 365, 1027, 1431
BstF5I GGATG 4 cut(s) 421, 478, 1218, 1255
BstKTI GATC 5 cut(s) 238, 347, 539, 766, 1167
BstMAI GTCTC 4 cut(s) 97, 368, 444, 562
BstMBI GATC 5 cut(s) 235, 344, 536, 763, 1164
BstMWI GCNNNNNNNGC 6 cut(s) 136, 191, 292, 425, 956, 1412
BstNI CCWGG 2 cut(s) 441, 738
BstPAI GACNNNNGTC 1 cut(s) 59
BstSCI CCNGG 3 cut(s) 399, 439, 736
BstSFI CTRYAG 3 cut(s) 57, 970, 1065
BstV1I GCAGC 2 cut(s) 956, 1415
BstX2I RGATCY 1 cut(s) 536
BstXI CCANNNNNNTGG 1 cut(s) 1159
BstYI RGATCY 1 cut(s) 536
BsuRI GGCC 2 cut(s) 483, 920
BtsCI GGATG 4 cut(s) 421, 478, 1218, 1255
BtsIMutI CAGTG 1 cut(s) 504
Cac8I GCNNGC 2 cut(s) 36, 922
Cfr13I GGNCC 2 cut(s) 1149, 1499
Csp6I GTAC 5 cut(s) 221, 319, 397, 1472, 1525
CviAII CATG 4 cut(s) 838, 880, 998, 1528
CviQI GTAC 5 cut(s) 221, 319, 397, 1472, 1525
DdeI CTNAG 4 cut(s) 177, 365, 1027, 1431
DpnI GATC 5 cut(s) 237, 346, 538, 765, 1166
DpnII GATC 5 cut(s) 235, 344, 536, 763, 1164
DrdI GACNNNNNNGTC 1 cut(s) 89
DseDI GACNNNNNNGTC 1 cut(s) 89
EaeI YGGCCR 1 cut(s) 481
Eco130I CCWWGG 1 cut(s) 87
Eco147I AGGCCT 1 cut(s) 920
Eco31I GGTCTC 1 cut(s) 97
Eco47I GGWCC 2 cut(s) 1149, 1499
Eco57I CTGAAG 2 cut(s) 756, 1428
Eco88I CYCGRG 1 cut(s) 757
EcoRI GAATTC 2 cut(s) 585, 1421
EcoRII CCWGG 2 cut(s) 439, 736
EcoT14I CCWWGG 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 430
ErhI CCWWGG 1 cut(s) 87
Esp3I CGTCTC 1 cut(s) 368
FaeI CATG 4 cut(s) 841, 883, 1001, 1531
FalI AAGNNNNNCTT 4 cut(s) 908, 940, 936, 968
FatI CATG 4 cut(s) 837, 879, 997, 1527
Fnu4HI GCNGC 3 cut(s) 948, 970, 1404
FokI GGATG 4 cut(s) 428, 485, 1225, 1262
Fsp4HI GCNGC 3 cut(s) 948, 970, 1404
FspBI CTAG 3 cut(s) 1283, 1373, 1391
GluI GCNGC 3 cut(s) 948, 970, 1404
GsuI CTGGAG 2 cut(s) 60, 1044
HaeIII GGCC 2 cut(s) 483, 920
HapII CCGG 2 cut(s) 401, 1462
Hin1II CATG 4 cut(s) 841, 883, 1001, 1531
HindIII AAGCTT 1 cut(s) 1508
HinfI GANTC 3 cut(s) 145, 206, 994
HpaII CCGG 2 cut(s) 401, 1462
HphI GGTGA 5 cut(s) 745, 1174, 1241, 1363, 1451
Hpy188I TCNGA 4 cut(s) 235, 768, 814, 898
Hpy188III TCNNGA 5 cut(s) 47, 64, 239, 413, 1426
HpyAV CCTTC 5 cut(s) 542, 743, 1002, 1094, 1403
HpyCH4III ACNGT 3 cut(s) 58, 941, 1339
HpyCH4IV ACGT 1 cut(s) 1474
HpyF10VI GCNNNNNNNGC 6 cut(s) 136, 191, 292, 425, 956, 1412
HpyF3I CTNAG 4 cut(s) 177, 365, 1027, 1431
HpySE526I ACGT 1 cut(s) 1474
Hsp92II CATG 4 cut(s) 841, 883, 1001, 1531
Kzo9I GATC 5 cut(s) 235, 344, 536, 763, 1164
LmnI GCTCC 3 cut(s) 1261, 1325, 1412
Lsp1109I GCAGC 2 cut(s) 956, 1415
LweI GCATC 3 cut(s) 406, 437, 463
MaeI CTAG 3 cut(s) 1283, 1373, 1391
MaeII ACGT 1 cut(s) 1474
MaeIII GTNAC 3 cut(s) 212, 457, 662
MalI GATC 5 cut(s) 237, 346, 538, 765, 1166
MboI GATC 5 cut(s) 235, 344, 536, 763, 1164
MboII GAAGA 7 cut(s) 581, 854, 917, 1014, 1017, 1300, 1396
MflI RGATCY 1 cut(s) 536
MlsI TGGCCA 1 cut(s) 483
MluCI AATT 4 cut(s) 585, 1173, 1300, 1421
MluNI TGGCCA 1 cut(s) 483
MlyI GAGTC 3 cut(s) 139, 200, 1003
MmeI TCCRAC 1 cut(s) 293
Mox20I TGGCCA 1 cut(s) 483
Mph1103I ATGCAT 1 cut(s) 430
MscI TGGCCA 1 cut(s) 483
MseI TTAA 3 cut(s) 687, 704, 1038
Msp20I TGGCCA 1 cut(s) 483
MspA1I CMGCKG 1 cut(s) 1406
MspI CCGG 2 cut(s) 401, 1462
MspR9I CCNGG 3 cut(s) 401, 441, 738
Mva1269I GAATGC 2 cut(s) 728, 914
MvaI CCWGG 2 cut(s) 441, 738
MwoI GCNNNNNNNGC 6 cut(s) 136, 191, 292, 425, 956, 1412
NciI CCSGG 1 cut(s) 401
NdeII GATC 5 cut(s) 235, 344, 536, 763, 1164
NlaIII CATG 4 cut(s) 841, 883, 1001, 1531
NlaIV GGNNCC 2 cut(s) 1150, 1257
NmuCI GTSAC 2 cut(s) 457, 662
NsiI ATGCAT 1 cut(s) 430
PceI AGGCCT 1 cut(s) 920
PcsI WCGNNNNNNNCGW 1 cut(s) 140
PctI GAATGC 2 cut(s) 728, 914
PflFI GACNNNGTC 1 cut(s) 886
PflMI CCANNNNNTGG 1 cut(s) 446
PfoI TCCNGGA 1 cut(s) 736
PkrI GCNGC 3 cut(s) 949, 971, 1405
PleI GAGTC 3 cut(s) 139, 200, 1002
PpsI GAGTC 3 cut(s) 139, 200, 1002
PshAI GACNNNNGTC 1 cut(s) 59
PsiI TTATAA 2 cut(s) 1206, 1344
Psp6I CCWGG 2 cut(s) 439, 736
PspGI CCWGG 2 cut(s) 439, 736
PspN4I GGNNCC 2 cut(s) 1150, 1257
PspPI GGNCC 2 cut(s) 1149, 1499
PstI CTGCAG 1 cut(s) 974
PsuI RGATCY 1 cut(s) 536
PsyI GACNNNGTC 1 cut(s) 886
PvuII CAGCTG 1 cut(s) 1406
RsaI GTAC 5 cut(s) 222, 320, 398, 1473, 1526
RsaNI GTAC 5 cut(s) 221, 319, 397, 1472, 1525
SaqAI TTAA 3 cut(s) 687, 704, 1038
SatI GCNGC 3 cut(s) 948, 970, 1404
Sau3AI GATC 5 cut(s) 235, 344, 536, 763, 1164
Sau96I GGNCC 2 cut(s) 1149, 1499
SchI GAGTC 3 cut(s) 139, 200, 1003
ScrFI CCNGG 3 cut(s) 401, 441, 738
SfaNI GCATC 3 cut(s) 406, 437, 463
SfcI CTRYAG 3 cut(s) 57, 970, 1065
SinI GGWCC 2 cut(s) 1149, 1499
SmlI CTYRAG 1 cut(s) 147
SmoI CTYRAG 1 cut(s) 147
Sse9I AATT 4 cut(s) 585, 1173, 1300, 1421
SseBI AGGCCT 1 cut(s) 920
SsiI CCGC 4 cut(s) 76, 681, 948, 1332
SspI AATATT 1 cut(s) 526
SspMI CTAG 3 cut(s) 1283, 1373, 1391
StuI AGGCCT 1 cut(s) 920
StyD4I CCNGG 3 cut(s) 399, 439, 736
StyI CCWWGG 1 cut(s) 87
TaaI ACNGT 3 cut(s) 58, 941, 1339
TaiI ACGT 1 cut(s) 1477
TaqI TCGA 2 cut(s) 143, 1261
TasI AATT 4 cut(s) 585, 1173, 1300, 1421
TatI WGTACW 3 cut(s) 220, 318, 1524
TauI GCSGC 1 cut(s) 950
Tru1I TTAA 3 cut(s) 687, 704, 1038
Tru9I TTAA 3 cut(s) 687, 704, 1038
TscAI CASTG 1 cut(s) 511
TseFI GTSAC 2 cut(s) 457, 662
TseI GCWGC 2 cut(s) 969, 1403
Tsp45I GTSAC 2 cut(s) 457, 662
TspDTI ATGAA 7 cut(s) 561, 834, 1024, 1122, 1229, 1290, 1451
TspGWI ACGGA 1 cut(s) 350
TspRI CASTG 1 cut(s) 511
Tth111I GACNNNGTC 1 cut(s) 886
Van91I CCANNNNNTGG 1 cut(s) 446
VpaK11BI GGWCC 2 cut(s) 1149, 1499
XapI RAATTY 2 cut(s) 585, 1421
XspI CTAG 3 cut(s) 1283, 1373, 1391
Zsp2I ATGCAT 1 cut(s) 430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.