Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000459.1

Orthogroup ID

OG0001104

Physical Location & Seq

Genomic Coordinates Reverse (-)

32586 .. 34832

Gene Structure 2247 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000459.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1485 bp

atggagaaatgttgtgagttctgcagagcattaaagccggtagtgtactgtaaagctgatgcagcacatctttgcctatcttgtgatgcaaagatccattcggctaacacagttttcaaccggcatcagcgcactgtcttatgtgaatcctgccaaggccgccctgcttatgttcagtgtttggatcacagaatgtttatgtgcaatgcctgtgacaggagccagcacacgtcatcttcccaacatcatcacaaacgcactatccggagttacacaggttgcccgtctgccaaggattttgcagcattgtggggtttccaatcaaatgagatagataacaagactctatccacctcttgtggttcttgtgactcgagtgtggtaagctatgatattcatgggcagtcttgctcacaaattgaatgtctttcaggtggtgctcggtttgaaatgggatcgaccagtaaacaatacgagatatattgtaaaggtgaagagcataagaagactggttttattctgcaccagatacttgacttggaaaggctgcagctagccaaagggaatagcccttcagcacagagtgacctatcttcttcagcacatcatacttggaacagctttgatgagaatcttgattggcatttacaacactgcaagactactggtactaactttcagctaaatgagagtccacttcagaatccgaaagatgatcctttgccatttctattttctcaagcggaacatttcccatcaaattcaactattggacttccattgcagacagaatccatttggcagtgcagaagtccggttcaaagtagtcagctgtggtctcaaaatatgcaagaccttggggtttgtgaagagcttgtttgtcacgacgatttcaacatacctgatgttgatttgacattccgaaatttcgaggaactctttggaggtgatcaagatcctaccagattgctgcttgatgataaagatgtctcatattcctccatggagagggacatgtccctcgataaatcagatgactgcaattcaagagcaatggtggatgtatcagaggcttcatccatgtaccttactcaacctgcagacttcgacaaagataccagtgcctgtaacaaagttgtagacgtttcgggaagcatggattcgaattctccacatgctattcgaccacctttttcaactttaccattctctgagtcgaggatattcaccgttagcaacaatgcagattgtcatgatacgcaacccttgagcacttcacctgatgtggatgctggacagctggaagtcggagcaagttctcggatgaggtacaaagagaagaagcattctcgactaacagagaagaaacttccatatccatctcggaaagctacaactaatatacataagctgggaaaaggccgaattgttacgacagaagaggaatacgattcagacaccattggtgtgacaagaagttactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CCT

Protein Analysis

494

Amino Acids

55.37

Weight (kDa)

5.58

Isoelectric Point (pI)

60.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001104)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G68190 AT1G68190 AT1G68190
fragaria_vesca	FvH4_4g26540 FvH4_4g26540 FvH4_4g26550
malus_domestica	MD13G1034200.v1.1 MD13G1034400.v1.1 MD16G1035900.v1.1
prunus_persica	Prupe.1G318100_v2.0.a1 Prupe.1G318100_v2.0.a1 Prupe.1G318100_v2.0.a1 Prupe.1G318100_v2.0.a1 Prupe.1G318400_v2.0.a1 Prupe.1G318400_v2.0.a1 Prupe.1G318400_v2.0.a1
pyrus_communis	pycom13g02950 pycom13g02960 pycom16g03080
rosa_chinensis	RchiOBHm_Chr4g0434171 RchiOBHm_Chr4g0434181 RchiOBHm_Chr4g0434191 RchiOBHm_Chr4g0434201
rosa_laevigata	RLG00000006693 RLG00000006694 RLG00000006695
rosa_multiflora	Rmu_sc0000459.1_g000002 Rmu_sc0000459.1_g000009
rosa_roxburghii	Rroxscaffold_5G00375560 Rroxscaffold_5G00375570 Rroxscaffold_5G00375580
rosa_rugosa	Rorug04G0274800 Rorug04G0274900 Rorug04G0275000.1 Rorug04G0275100 Rorug04G0275200 Rorug04G0275300 Rorug04G0275400
rosa_samantha	Rh4AG329700 Rh4AG329800 Rh4AG329900 Rh4AG330000 Rh4BG337300 Rh4BG337400 Rh4BG337500 Rh4BG337600 Rh4CG352700 Rh4CG352800 Rh4CG352900 Rh4CG353000 Rh4DG333300 Rh4DG333400 Rh4DG333500 Rh4DG333600
rosa_wichuraiana	Rw0G007010 Rw0G007020 Rw4G028590 Rw4G028600 Rw4G028620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1105
AccI	GTMKAC	1 cut(s)	1140
AccIII	TCCGGA	1 cut(s)	264
AciI	CCGC	2 cut(s)	160, 743
AclWI	GGATC	5 cut(s)	88, 192, 463, 710, 950
AcsI	RAATTY	3 cut(s)	760, 925, 1165
AcuI	CTGAAG	3 cut(s)	558, 582, 683
AdeI	CACNNNGTG	1 cut(s)	584
AfaI	GTAC	4 cut(s)	47, 670, 1085, 1331
AfiI	CCNNNNNNNGG	2 cut(s)	216, 1008
AflIII	ACRYGT	2 cut(s)	228, 1014
AgsI	TTSAA	8 cut(s)	118, 422, 449, 765, 821, 895, 1047, 1197
AjiI	CACGTC	1 cut(s)	231
Alw21I	GWGCWC	2 cut(s)	442, 1274
Alw26I	GTCTC	2 cut(s)	843, 994
AlwI	GGATC	5 cut(s)	88, 192, 463, 710, 950
AlwNI	CAGNNNCTG	1 cut(s)	1125
Ama87I	CYCGRG	1 cut(s)	373
Aor13HI	TCCGGA	1 cut(s)	264
AoxI	GGCC	2 cut(s)	157, 1420
ApeKI	GCWGC	5 cut(s)	62, 302, 547, 550, 970
ApoI	RAATTY	3 cut(s)	760, 925, 1165
ArsI	GACNNNNNNTTYG	2 cut(s)	409, 441
AspLEI	GCGC	1 cut(s)	132
AsuHPI	GGTGA	4 cut(s)	503, 959, 1219, 1269
AsuII	TTCGAA	1 cut(s)	1163
AsuNHI	GCTAGC	1 cut(s)	553
AvaI	CYCGRG	1 cut(s)	373
BbsI	GAAGAC	1 cut(s)	512
Bbv12I	GWGCWC	2 cut(s)	442, 1274
BbvI	GCAGC	5 cut(s)	74, 314, 534, 562, 957
BccI	CCATC	2 cut(s)	763, 1387
BclI	TGATCA	1 cut(s)	949
BcoDI	GTCTC	2 cut(s)	843, 994
BfaI	CTAG	1 cut(s)	554
BfmI	CTRYAG	3 cut(s)	22, 548, 1098
BfuAI	ACCTGC	1 cut(s)	1105
BisI	GCNGC	6 cut(s)	63, 160, 303, 548, 551, 971
BlsI	GCNGC	6 cut(s)	64, 161, 304, 549, 552, 972
BmeT110I	CYCGRG	1 cut(s)	373
BmgBI	CACGTC	1 cut(s)	231
BmiI	GGNNCC	1 cut(s)	221
BmsI	GCATC	4 cut(s)	49, 76, 133, 1279
BmtI	GCTAGC	1 cut(s)	557
BpiI	GAAGAC	1 cut(s)	512
Bpu14I	TTCGAA	1 cut(s)	1163
BpuEI	CTTGAG	2 cut(s)	723, 1288
BsaBI	GATNNNNATC	2 cut(s)	630, 954
BsaI	GGTCTC	1 cut(s)	843
BsaJI	CCNNGG	4 cut(s)	154, 291, 856, 1002
BsaWI	WCCGGW	2 cut(s)	264, 814
Bsc4I	CCNNNNNNNGG	2 cut(s)	216, 1008
Bse118I	RCCGGY	2 cut(s)	37, 120
Bse1I	ACTGG	4 cut(s)	462, 514, 670, 1119
Bse3DI	GCAATG	3 cut(s)	211, 779, 1059
Bse8I	GATNNNNATC	2 cut(s)	630, 954
BseAI	TCCGGA	1 cut(s)	264
BseDI	CCNNGG	4 cut(s)	154, 291, 856, 1002
BseGI	GGATG	4 cut(s)	1066, 1076, 1294, 1329
BseJI	GATNNNNATC	2 cut(s)	630, 954
BseLI	CCNNNNNNNGG	2 cut(s)	216, 1008
BseMI	GCAATG	3 cut(s)	211, 779, 1059
BseMII	CTCAG	1 cut(s)	1203
BseNI	ACTGG	4 cut(s)	462, 514, 670, 1119
BseXI	GCAGC	5 cut(s)	74, 314, 534, 562, 957
BseYI	CCCAGC	1 cut(s)	1411
BsgI	GTGCAG	2 cut(s)	506, 826
BshFI	GGCC	2 cut(s)	159, 1422
BsiHKAI	GWGCWC	2 cut(s)	442, 1274
BsiHKCI	CYCGRG	1 cut(s)	373
BsiSI	CCGG	4 cut(s)	38, 121, 265, 815
BslFI	GGGAC	2 cut(s)	1003, 1025
BslI	CCNNNNNNNGG	2 cut(s)	216, 1008
BsmAI	GTCTC	2 cut(s)	843, 994
BsmFI	GGGAC	2 cut(s)	1003, 1025
BsmI	GAATGC	1 cut(s)	1345
BsnI	GGCC	2 cut(s)	159, 1422
Bso31I	GGTCTC	1 cut(s)	843
BsoBI	CYCGRG	1 cut(s)	373
Bsp119I	TTCGAA	1 cut(s)	1163
Bsp1286I	GDGCHC	2 cut(s)	442, 1274
Bsp13I	TCCGGA	1 cut(s)	264
Bsp143I	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
Bsp19I	CCATGG	1 cut(s)	1002
BspACI	CCGC	2 cut(s)	160, 743
BspANI	GGCC	2 cut(s)	159, 1422
BspCNI	CTCAG	1 cut(s)	1204
BspEI	TCCGGA	1 cut(s)	264
BspHI	TCATGA	1 cut(s)	1252
BspLI	GGNNCC	1 cut(s)	221
BspMAI	CTGCAG	3 cut(s)	26, 552, 1102
BspMI	ACCTGC	1 cut(s)	1105
BspOI	GCTAGC	1 cut(s)	557
BspPI	GGATC	5 cut(s)	88, 192, 463, 710, 950
BspQI	GCTCTTC	2 cut(s)	489, 864
BspT104I	TTCGAA	1 cut(s)	1163
BspTNI	GGTCTC	1 cut(s)	843
BsrDI	GCAATG	3 cut(s)	211, 779, 1059
BsrFI	RCCGGY	2 cut(s)	37, 120
BsrI	ACTGG	4 cut(s)	462, 514, 670, 1119
BssAI	RCCGGY	2 cut(s)	37, 120
BssECI	CCNNGG	4 cut(s)	154, 291, 856, 1002
BssMI	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
BssT1I	CCWWGG	4 cut(s)	154, 291, 856, 1002
Bst4CI	ACNGT	4 cut(s)	50, 112, 136, 1231
Bst6I	CTCTTC	3 cut(s)	489, 864, 1434
BstBI	TTCGAA	1 cut(s)	1163
BstC8I	GCNNGC	2 cut(s)	224, 555
BstDEI	CTNAG	1 cut(s)	1212
BstDSI	CCRYGG	1 cut(s)	1002
BstENI	CCTNNNNNAGG	1 cut(s)	214
BstF5I	GGATG	4 cut(s)	1066, 1076, 1294, 1329
BstHHI	GCGC	1 cut(s)	132
BstKTI	GATC	6 cut(s)	96, 187, 458, 718, 952, 958
BstMAI	GTCTC	2 cut(s)	843, 994
BstMBI	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
BstMWI	GCNNNNNNNGC	2 cut(s)	62, 159
BstNSI	RCATGY	2 cut(s)	1018, 1178
BstSFI	CTRYAG	3 cut(s)	22, 548, 1098
BstV1I	GCAGC	5 cut(s)	74, 314, 534, 562, 957
BstV2I	GAAGAC	1 cut(s)	512
BstX2I	RGATCY	2 cut(s)	93, 955
BstYI	RGATCY	2 cut(s)	93, 955
BsuRI	GGCC	2 cut(s)	159, 1422
BtgI	CCRYGG	1 cut(s)	1002
BtrI	CACGTC	1 cut(s)	231
BtsCI	GGATG	4 cut(s)	1066, 1076, 1294, 1329
BtsI	GCAGTG	2 cut(s)	652, 809
BtsIMutI	CAGTG	5 cut(s)	132, 182, 652, 809, 1126
BveI	ACCTGC	1 cut(s)	1105
Cac8I	GCNNGC	2 cut(s)	224, 555
CaiI	CAGNNNCTG	1 cut(s)	1125
CciI	TCATGA	1 cut(s)	1252
CfoI	GCGC	1 cut(s)	132
Cfr10I	RCCGGY	2 cut(s)	37, 120
Csp6I	GTAC	4 cut(s)	46, 669, 1084, 1330
CviAII	CATG	7 cut(s)	398, 1003, 1015, 1081, 1156, 1175, 1253
CviQI	GTAC	4 cut(s)	46, 669, 1084, 1330
DdeI	CTNAG	1 cut(s)	1212
DpnI	GATC	6 cut(s)	95, 186, 457, 717, 951, 957
DpnII	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
DraIII	CACNNNGTG	1 cut(s)	584
Eam1104I	CTCTTC	3 cut(s)	489, 864, 1434
EarI	CTCTTC	3 cut(s)	489, 864, 1434
Eco130I	CCWWGG	4 cut(s)	154, 291, 856, 1002
Eco31I	GGTCTC	1 cut(s)	843
Eco57I	CTGAAG	3 cut(s)	558, 582, 683
Eco88I	CYCGRG	1 cut(s)	373
EcoNI	CCTNNNNNAGG	1 cut(s)	214
EcoRI	GAATTC	1 cut(s)	1165
EcoT14I	CCWWGG	4 cut(s)	154, 291, 856, 1002
ErhI	CCWWGG	4 cut(s)	154, 291, 856, 1002
FaeI	CATG	7 cut(s)	401, 1006, 1018, 1084, 1159, 1178, 1256
FaqI	GGGAC	2 cut(s)	1003, 1025
FatI	CATG	7 cut(s)	397, 1002, 1014, 1080, 1155, 1174, 1252
FbaI	TGATCA	1 cut(s)	949
FblI	GTMKAC	1 cut(s)	1140
Fnu4HI	GCNGC	6 cut(s)	63, 160, 303, 548, 551, 971
FokI	GGATG	4 cut(s)	1063, 1073, 1301, 1336
Fsp4HI	GCNGC	6 cut(s)	63, 160, 303, 548, 551, 971
FspBI	CTAG	1 cut(s)	554
GlaI	GCGC	1 cut(s)	131
GluI	GCNGC	6 cut(s)	63, 160, 303, 548, 551, 971
GsaI	CCCAGC	1 cut(s)	1415
HaeIII	GGCC	2 cut(s)	159, 1422
HapII	CCGG	4 cut(s)	38, 121, 265, 815
HhaI	GCGC	1 cut(s)	132
Hin1II	CATG	7 cut(s)	401, 1006, 1018, 1084, 1159, 1178, 1256
Hin6I	GCGC	1 cut(s)	130
HinP1I	GCGC	1 cut(s)	130
HpaII	CCGG	4 cut(s)	38, 121, 265, 815
HphI	GGTGA	4 cut(s)	503, 959, 1219, 1269
Hpy166II	GTNNAC	4 cut(s)	46, 467, 695, 1141
Hpy188III	TCNNGA	8 cut(s)	265, 635, 884, 953, 1047, 1149, 1253, 1350
Hpy8I	GTNNAC	4 cut(s)	46, 467, 695, 1141
Hpy99I	CGWCG	1 cut(s)	890
HpyAV	CCTTC	1 cut(s)	582
HpyCH4III	ACNGT	4 cut(s)	50, 112, 136, 1231
HpyCH4IV	ACGT	2 cut(s)	230, 1143
HpyF10VI	GCNNNNNNNGC	2 cut(s)	62, 159
HpyF3I	CTNAG	1 cut(s)	1212
HpySE526I	ACGT	2 cut(s)	230, 1143
Hsp92II	CATG	7 cut(s)	401, 1006, 1018, 1084, 1159, 1178, 1256
HspAI	GCGC	1 cut(s)	130
Kpn2I	TCCGGA	1 cut(s)	264
Ksp22I	TGATCA	1 cut(s)	949
Kzo9I	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
LguI	GCTCTTC	2 cut(s)	489, 864
LmnI	GCTCC	2 cut(s)	219, 1310
Lsp1109I	GCAGC	5 cut(s)	74, 314, 534, 562, 957
LweI	GCATC	4 cut(s)	49, 76, 133, 1279
MaeI	CTAG	1 cut(s)	554
MaeII	ACGT	2 cut(s)	230, 1143
MaeIII	GTNAC	9 cut(s)	212, 269, 368, 584, 881, 1127, 1429, 1468, 1478
MalI	GATC	6 cut(s)	95, 186, 457, 717, 951, 957
MboI	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
MboII	GAAGA	9 cut(s)	228, 506, 517, 585, 588, 881, 1351, 1375, 1451
MflI	RGATCY	2 cut(s)	93, 955
MhlI	GDGCHC	2 cut(s)	442, 1274
MluCI	AATT	6 cut(s)	417, 760, 925, 1042, 1165, 1425
MlyI	GAGTC	4 cut(s)	337, 365, 700, 1223
MmeI	TCCRAC	1 cut(s)	1288
MroI	TCCGGA	1 cut(s)	264
MseI	TTAA	1 cut(s)	32
MslI	CAYNNNNRTG	1 cut(s)	1466
MspA1I	CMGCKG	2 cut(s)	832, 1300
MspI	CCGG	4 cut(s)	38, 121, 265, 815
Mva1269I	GAATGC	1 cut(s)	1345
MwoI	GCNNNNNNNGC	2 cut(s)	62, 159
NcoI	CCATGG	1 cut(s)	1002
NdeII	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
NheI	GCTAGC	1 cut(s)	553
NlaIII	CATG	7 cut(s)	401, 1006, 1018, 1084, 1159, 1178, 1256
NlaIV	GGNNCC	1 cut(s)	221
NmuCI	GTSAC	5 cut(s)	212, 368, 584, 881, 1468
NspI	RCATGY	2 cut(s)	1018, 1178
NspV	TTCGAA	1 cut(s)	1163
PaeR7I	CTCGAG	1 cut(s)	373
PagI	TCATGA	1 cut(s)	1252
PciI	ACATGT	1 cut(s)	1014
PciSI	GCTCTTC	2 cut(s)	489, 864
PctI	GAATGC	1 cut(s)	1345
PfeI	GAWTC	6 cut(s)	146, 631, 703, 791, 1160, 1451
PkrI	GCNGC	6 cut(s)	64, 161, 304, 549, 552, 972
PleI	GAGTC	4 cut(s)	337, 365, 699, 1222
PpsI	GAGTC	4 cut(s)	337, 365, 699, 1222
PscI	ACATGT	1 cut(s)	1014
PspFI	CCCAGC	1 cut(s)	1411
PspN4I	GGNNCC	1 cut(s)	221
PspXI	VCTCGAGB	1 cut(s)	373
PstI	CTGCAG	3 cut(s)	26, 552, 1102
PstNI	CAGNNNCTG	1 cut(s)	1125
PsuI	RGATCY	2 cut(s)	93, 955
PvuII	CAGCTG	2 cut(s)	832, 1300
RsaI	GTAC	4 cut(s)	47, 670, 1085, 1331
RsaNI	GTAC	4 cut(s)	46, 669, 1084, 1330
RseI	CAYNNNNRTG	1 cut(s)	1466
SapI	GCTCTTC	2 cut(s)	489, 864
SaqAI	TTAA	1 cut(s)	32
SatI	GCNGC	6 cut(s)	63, 160, 303, 548, 551, 971
Sau3AI	GATC	6 cut(s)	93, 184, 455, 715, 949, 955
SchI	GAGTC	4 cut(s)	337, 365, 700, 1223
SduI	GDGCHC	2 cut(s)	442, 1274
SfaNI	GCATC	4 cut(s)	49, 76, 133, 1279
SfcI	CTRYAG	3 cut(s)	22, 548, 1098
Sfr274I	CTCGAG	1 cut(s)	373
SfuI	TTCGAA	1 cut(s)	1163
SlaI	CTCGAG	1 cut(s)	373
SmiMI	CAYNNNNRTG	1 cut(s)	1466
SmlI	CTYRAG	3 cut(s)	373, 738, 1267
SmoI	CTYRAG	3 cut(s)	373, 738, 1267
Sse9I	AATT	6 cut(s)	417, 760, 925, 1042, 1165, 1425
SsiI	CCGC	2 cut(s)	160, 743
SspMI	CTAG	1 cut(s)	554
StyI	CCWWGG	4 cut(s)	154, 291, 856, 1002
TaaI	ACNGT	4 cut(s)	50, 112, 136, 1231
TaiI	ACGT	2 cut(s)	233, 1146
TaqI	TCGA	9 cut(s)	374, 458, 930, 1023, 1107, 1163, 1183, 1217, 1351
TasI	AATT	6 cut(s)	417, 760, 925, 1042, 1165, 1425
TatI	WGTACW	1 cut(s)	45
TauI	GCSGC	1 cut(s)	162
TfiI	GAWTC	6 cut(s)	146, 631, 703, 791, 1160, 1451
Tru1I	TTAA	1 cut(s)	32
Tru9I	TTAA	1 cut(s)	32
TscAI	CASTG	5 cut(s)	139, 182, 659, 809, 1126
TseFI	GTSAC	5 cut(s)	212, 368, 584, 881, 1468
TseI	GCWGC	5 cut(s)	62, 302, 547, 550, 970
Tsp45I	GTSAC	5 cut(s)	212, 368, 584, 881, 1468
TspDTI	ATGAA	2 cut(s)	386, 1065
TspRI	CASTG	5 cut(s)	139, 182, 659, 809, 1126
XagI	CCTNNNNNAGG	1 cut(s)	214
XapI	RAATTY	3 cut(s)	760, 925, 1165
XceI	RCATGY	2 cut(s)	1018, 1178
XhoI	CTCGAG	1 cut(s)	373
XmiI	GTMKAC	1 cut(s)	1140
XspI	CTAG	1 cut(s)	554

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.