Rh4AG329700

Zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
64027880 .. 64028671
792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG329700.1

Sequence Viewer

Length: 273 bp
ATGATTGTCAATCTCAATGTCAACAACGCCCACCATCAGCTGCGATCTGAAAAGATGCAAGACCAGCTTGGGGTTTGTGATGATGATTCAAATATACCTGATGATGAGTATCTAGCATTCCTGAACTTGGAAGAACTAATCGGAGACGAAGATGATCAAGATCTTATTCTGAGAACCCAGAAGCTGCTTGATGATCACGGGAACGGCAATTATCACAATCTAGACATGCATGCAAAGGAAAATTCGATATCAAAAGAGGAAAGCCATAGCTGA

Protein Analysis

90

Amino Acids

10.33

Weight (kDa)

4.33

Isoelectric Point (pI)

51.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 241
AfiI CCNNNNNNNGG 2 cut(s) 70, 127
AgsI TTSAA 1 cut(s) 90
AluBI AGCT 4 cut(s) 40, 67, 184, 270
AluI AGCT 4 cut(s) 40, 67, 184, 270
Alw26I GTCTC 1 cut(s) 138
AlwNI CAGNNNCTG 1 cut(s) 184
ApeKI GCWGC 2 cut(s) 40, 184
ApoI RAATTY 1 cut(s) 241
BbvI GCAGC 2 cut(s) 27, 171
BccI CCATC 1 cut(s) 42
BceAI ACGGC 1 cut(s) 220
BclI TGATCA 2 cut(s) 154, 193
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 2 cut(s) 113, 221
BglII AGATCT 1 cut(s) 160
BisI GCNGC 2 cut(s) 41, 185
BlsI GCNGC 2 cut(s) 42, 186
BmsI GCATC 1 cut(s) 45
BsaBI GATNNNNATC 2 cut(s) 108, 159
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 127
Bse8I GATNNNNATC 2 cut(s) 108, 159
BseJI GATNNNNATC 2 cut(s) 108, 159
BseLI CCNNNNNNNGG 2 cut(s) 70, 127
BseMII CTCAG 1 cut(s) 161
BseXI GCAGC 2 cut(s) 27, 171
BslI CCNNNNNNNGG 2 cut(s) 70, 127
BsmAI GTCTC 1 cut(s) 138
BsmBI CGTCTC 1 cut(s) 138
BsmI GAATGC 1 cut(s) 116
Bsp143I GATC 4 cut(s) 44, 154, 160, 193
BspCNI CTCAG 1 cut(s) 162
BssMI GATC 4 cut(s) 44, 154, 160, 193
BstC8I GCNNGC 1 cut(s) 231
BstDEI CTNAG 1 cut(s) 170
BstKTI GATC 4 cut(s) 47, 157, 163, 196
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 4 cut(s) 44, 154, 160, 193
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNSI RCATGY 2 cut(s) 229, 233
BstV1I GCAGC 2 cut(s) 27, 171
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
Cac8I GCNNGC 1 cut(s) 231
CaiI CAGNNNCTG 1 cut(s) 184
CviAII CATG 2 cut(s) 226, 230
CviJI RGCY 5 cut(s) 40, 67, 184, 264, 270
CviKI_1 RGCY 5 cut(s) 40, 67, 184, 264, 270
DdeI CTNAG 1 cut(s) 170
DpnI GATC 4 cut(s) 46, 156, 162, 195
DpnII GATC 4 cut(s) 44, 154, 160, 193
Eco32I GATATC 1 cut(s) 249
EcoRV GATATC 1 cut(s) 249
EcoT22I ATGCAT 1 cut(s) 231
Esp3I CGTCTC 1 cut(s) 138
FaeI CATG 2 cut(s) 229, 233
FaiI YATR 4 cut(s) 95, 227, 231, 267
FalI AAGNNNNNCTT 2 cut(s) 51, 83
FatI CATG 2 cut(s) 225, 229
FbaI TGATCA 2 cut(s) 154, 193
Fnu4HI GCNGC 2 cut(s) 41, 185
Fsp4HI GCNGC 2 cut(s) 41, 185
FspBI CTAG 2 cut(s) 113, 221
GluI GCNGC 2 cut(s) 41, 185
Hin1II CATG 2 cut(s) 229, 233
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 3 cut(s) 49, 143, 171
Hpy188III TCNNGA 3 cut(s) 121, 158, 221
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4V TGCA 3 cut(s) 58, 229, 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 170
Hsp92II CATG 2 cut(s) 229, 233
Ksp22I TGATCA 2 cut(s) 154, 193
Kzo9I GATC 4 cut(s) 44, 154, 160, 193
LpnPI CCDG 4 cut(s) 77, 111, 134, 191
Lsp1109I GCAGC 2 cut(s) 27, 171
LweI GCATC 1 cut(s) 45
MaeI CTAG 2 cut(s) 113, 221
MalI GATC 4 cut(s) 46, 156, 162, 195
MboI GATC 4 cut(s) 44, 154, 160, 193
MboII GAAGA 2 cut(s) 143, 161
MflI RGATCY 1 cut(s) 160
MluCI AATT 2 cut(s) 208, 241
MnlI CCTC 1 cut(s) 250
Mph1103I ATGCAT 1 cut(s) 231
MspA1I CMGCKG 1 cut(s) 40
Mva1269I GAATGC 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 4 cut(s) 44, 154, 160, 193
NlaIII CATG 2 cut(s) 229, 233
NsiI ATGCAT 1 cut(s) 231
NspI RCATGY 2 cut(s) 229, 233
PaeI GCATGC 1 cut(s) 233
PctI GAATGC 1 cut(s) 116
PfeI GAWTC 1 cut(s) 86
PkrI GCNGC 2 cut(s) 42, 186
PstNI CAGNNNCTG 1 cut(s) 184
PsuI RGATCY 1 cut(s) 160
PvuII CAGCTG 1 cut(s) 40
SatI GCNGC 2 cut(s) 41, 185
Sau3AI GATC 4 cut(s) 44, 154, 160, 193
SetI ASST 5 cut(s) 42, 69, 100, 186, 272
SfaNI GCATC 1 cut(s) 45
SphI GCATGC 1 cut(s) 233
Sse9I AATT 2 cut(s) 208, 241
SspMI CTAG 2 cut(s) 113, 221
TaqI TCGA 1 cut(s) 245
TasI AATT 2 cut(s) 208, 241
TfiI GAWTC 1 cut(s) 86
TseI GCWGC 2 cut(s) 40, 184
XapI RAATTY 1 cut(s) 241
XbaI TCTAGA 1 cut(s) 220
XceI RCATGY 2 cut(s) 229, 233
XspI CTAG 2 cut(s) 113, 221
Zsp2I ATGCAT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.