Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000617.1

Orthogroup ID

OG0002151

Physical Location & Seq

Genomic Coordinates Reverse (-)

91889 .. 92938

Gene Structure 1050 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000617.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1050 bp

atggatttctgctgggaggacccgtatgatgagtatgatctcagtagggtcatccgcagggggtataagcggtggttgaaaaagaatatgaaggcaaggaagaaggctaagaaggagtacaacaacaaggtgccggatttggcacataatacgaagaggctggacaagagggtcatgcagatgatgatggcgaagagggaggaggaaaggaagagggagatggagaaggaaagggagaggaggaagcggttgaagaaggagaagctggcgaaggccgctatggagtatgaggagccggagtggaccaaagtggttgagaggaagagaaaatatggtgatcctgaggatgagaaggaaaaggagagagaggaatgggagtgcttggtttgtagaaaggggtttaggaatgaaaagcagtgtcggaatcacgagcagtcgaagaagcacctccgcatggttatggagttgctgaagttgaaacattatgatatggttgcggagttgattgaggtagagagaaattatgaagaacttaatgaagaagaggttttaatggaggaaaaaaggaatgaggtggtggatgatggggttggagggagtgatagtaacgaaaatgaattttctccttgtggtaacgagaatcagaaggaaaaagtcggtgaaatagttgaagtcgatgaggtggaggtggaggtggaggaggaggaggatgaggatgagatgaattttcttgaagcaatggtggcgaggcgaaaggctatggaaaaggtttgtgacgatgttcttgaaccaatgtttgaggtcatggcgaccaatatgcatgtggagaatgatgttaatgaggtggctatagagcatcatgataagctaaagagcacgaataataaaattggaggagggaagaaaccgaggaggaggagtgtggagtgtactagaattaacgagcacgataattctcctaattcaaatatgaaggaaatcaaatctgattccagtgcagaagaaaaggaaagcaaggaagaaagagaagaggtgcaaagaaagtactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ zf-C2H2_jaz

Protein Analysis

349

Amino Acids

42.01

Weight (kDa)

5.41

Isoelectric Point (pI)

60.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002151)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g18280 FvH4_5g00881
rosa_chinensis	RchiOBHm_Chr2g0129311 RchiOBHm_Chr2g0129321 RchiOBHm_Chr7g0200501 RchiOBHm_Chr7g0200511 RchiOBHm_Chr7g0200711
rosa_laevigata	RLG00000001973 RLG00000003685 RLG00000003700 RLG00000003704 RLG00000003705 RLG00000003720
rosa_multiflora	Rmu_sc0000617.1_g000002 Rmu_sc0000617.1_g000021 Rmu_sc0000617.1_g000022 Rmu_sc0000708.1_g000001 Rmu_sc0000708.1_g000002 Rmu_sc0000708.1_g000010 Rmu_sc0000785.1_g000029 Rmu_sc0000785.1_g000030 Rmu_sc0005230.1_g000017
rosa_roxburghii	Rroxscaffold_3G00255460 Rroxscaffold_3G00255630 Rroxscaffold_3G00255800 Rroxscaffold_3G00255810 Rroxscaffold_3G00255910
rosa_rugosa	Rorug05G0441400.1 Rorug07G0060700 Rorug07G0061200
rosa_samantha	Rh2DG363700 Rh2DG363800 Rh7AG187000 Rh7AG188800 Rh7AG188900 Rh7BG189300 Rh7BG190200 Rh7BG192000 Rh7DG190400 Rh7DG190900 Rh7DG194200
rosa_wichuraiana	Rw0G002940 Rw7G016360 Rw7G016610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	170
AccB1I	GGYRCC	1 cut(s)	130
AciI	CCGC	6 cut(s)	55, 70, 247, 276, 451, 497
AclWI	GGATC	1 cut(s)	332
AcsI	RAATTY	2 cut(s)	617, 724
AcuI	CTGAAG	1 cut(s)	491
AfaI	GTAC	3 cut(s)	119, 931, 1046
AfiI	CCNNNNNNNGG	1 cut(s)	454
AgsI	TTSAA	7 cut(s)	79, 253, 478, 671, 734, 788, 966
AluBI	AGCT	2 cut(s)	265, 868
AluI	AGCT	2 cut(s)	265, 868
Alw21I	GWGCWC	2 cut(s)	878, 948
AlwI	GGATC	1 cut(s)	332
AoxI	GGCC	1 cut(s)	273
ApoI	RAATTY	2 cut(s)	617, 724
AspS9I	GGNCC	2 cut(s)	19, 303
AsuHPI	GGTGA	2 cut(s)	347, 671
AvaII	GGWCC	2 cut(s)	19, 303
AxyI	CCTNAGG	1 cut(s)	342
BanI	GGYRCC	1 cut(s)	130
BauI	CACGAG	1 cut(s)	428
Bbv12I	GWGCWC	2 cut(s)	878, 948
BccI	CCATC	3 cut(s)	181, 214, 578
BcgI	CGANNNNNNTGC	2 cut(s)	799, 833
BfaI	CTAG	2 cut(s)	933, 1048
BfmI	CTRYAG	1 cut(s)	849
BisI	GCNGC	1 cut(s)	276
BlsI	GCNGC	1 cut(s)	277
BmcAI	AGTACT	1 cut(s)	1046
Bme18I	GGWCC	2 cut(s)	19, 303
BmgT120I	GGNCC	2 cut(s)	19, 303
BmiI	GGNNCC	3 cut(s)	21, 132, 294
BmsI	GCATC	1 cut(s)	865
BsaJI	CCNNGG	1 cut(s)	908
BsaXI	ACNNNNNCTCC	8 cut(s)	8, 38, 284, 314, 589, 619, 904, 934
Bsc4I	CCNNNNNNNGG	1 cut(s)	454
Bse1I	ACTGG	1 cut(s)	993
Bse21I	CCTNAGG	1 cut(s)	342
Bse3DI	GCAATG	1 cut(s)	744
BseDI	CCNNGG	1 cut(s)	908
BseGI	GGATG	5 cut(s)	51, 352, 586, 715, 721
BseLI	CCNNNNNNNGG	1 cut(s)	454
BseMI	GCAATG	1 cut(s)	744
BseMII	CTCAG	2 cut(s)	55, 333
BseNI	ACTGG	1 cut(s)	993
BseYI	CCCAGC	1 cut(s)	12
BsgI	GTGCAG	1 cut(s)	1017
BshFI	GGCC	1 cut(s)	275
BshNI	GGYRCC	1 cut(s)	130
BsiHKAI	GWGCWC	2 cut(s)	878, 948
BsiSI	CCGG	2 cut(s)	134, 296
BslI	CCNNNNNNNGG	1 cut(s)	454
BsnI	GGCC	1 cut(s)	275
Bsp1286I	GDGCHC	2 cut(s)	878, 948
Bsp143I	GATC	2 cut(s)	37, 337
BspACI	CCGC	6 cut(s)	55, 70, 247, 276, 451, 497
BspANI	GGCC	1 cut(s)	275
BspCNI	CTCAG	2 cut(s)	54, 334
BspHI	TCATGA	1 cut(s)	859
BspLI	GGNNCC	3 cut(s)	21, 132, 294
BspPI	GGATC	1 cut(s)	332
BspT107I	GGYRCC	1 cut(s)	130
BsrDI	GCAATG	1 cut(s)	744
BsrI	ACTGG	1 cut(s)	993
BssECI	CCNNGG	1 cut(s)	908
BssMI	GATC	2 cut(s)	37, 337
BssSI	CACGAG	1 cut(s)	428
Bst2BI	CACGAG	1 cut(s)	428
Bst6I	CTCTTC	6 cut(s)	149, 188, 206, 317, 537, 1023
BstC8I	GCNNGC	1 cut(s)	267
BstDEI	CTNAG	3 cut(s)	41, 108, 342
BstF5I	GGATG	5 cut(s)	51, 352, 586, 715, 721
BstKTI	GATC	2 cut(s)	40, 340
BstMBI	GATC	2 cut(s)	37, 337
BstMWI	GCNNNNNNNGC	2 cut(s)	275, 743
BstNSI	RCATGY	1 cut(s)	824
BstSFI	CTRYAG	1 cut(s)	849
Bsu36I	CCTNAGG	1 cut(s)	342
BsuRI	GGCC	1 cut(s)	275
BtsCI	GGATG	5 cut(s)	51, 352, 586, 715, 721
BtsI	GCAGTG	1 cut(s)	422
BtsIMutI	CAGTG	2 cut(s)	422, 1000
Cac8I	GCNNGC	1 cut(s)	267
CciI	TCATGA	1 cut(s)	859
Cfr13I	GGNCC	2 cut(s)	19, 303
Csp6I	GTAC	3 cut(s)	118, 930, 1045
CviAII	CATG	5 cut(s)	175, 454, 805, 821, 860
CviJI	RGCY	8 cut(s)	107, 160, 265, 275, 295, 758, 848, 868
CviKI_1	RGCY	8 cut(s)	107, 160, 265, 275, 295, 758, 848, 868
CviQI	GTAC	3 cut(s)	118, 930, 1045
DdeI	CTNAG	3 cut(s)	41, 108, 342
DpnI	GATC	2 cut(s)	39, 339
DpnII	GATC	2 cut(s)	37, 337
DrdI	GACNNNNNNGTC	1 cut(s)	170
DseDI	GACNNNNNNGTC	1 cut(s)	170
Eam1104I	CTCTTC	6 cut(s)	149, 188, 206, 317, 537, 1023
EarI	CTCTTC	6 cut(s)	149, 188, 206, 317, 537, 1023
Eco47I	GGWCC	2 cut(s)	19, 303
Eco57I	CTGAAG	1 cut(s)	491
Eco81I	CCTNAGG	1 cut(s)	342
EcoO109I	RGGNCCY	1 cut(s)	19
EcoT22I	ATGCAT	1 cut(s)	822
FaeI	CATG	5 cut(s)	178, 457, 808, 824, 863
FatI	CATG	5 cut(s)	174, 453, 804, 820, 859
Fnu4HI	GCNGC	1 cut(s)	276
FokI	GGATG	5 cut(s)	38, 359, 593, 722, 728
Fsp4HI	GCNGC	1 cut(s)	276
FspBI	CTAG	2 cut(s)	933, 1048
GluI	GCNGC	1 cut(s)	276
GsaI	CCCAGC	1 cut(s)	16
HaeIII	GGCC	1 cut(s)	275
HapII	CCGG	2 cut(s)	134, 296
Hin1II	CATG	5 cut(s)	178, 457, 808, 824, 863
HinfI	GANTC	3 cut(s)	424, 640, 989
HpaII	CCGG	2 cut(s)	134, 296
HphI	GGTGA	2 cut(s)	347, 671
Hpy166II	GTNNAC	2 cut(s)	303, 930
Hpy188I	TCNGA	3 cut(s)	423, 645, 988
Hpy188III	TCNNGA	5 cut(s)	341, 428, 731, 785, 860
Hpy8I	GTNNAC	2 cut(s)	303, 930
HpyAV	CCTTC	9 cut(s)	85, 97, 106, 220, 250, 265, 346, 640, 967
HpyCH4V	TGCA	4 cut(s)	178, 820, 998, 1036
HpyF10VI	GCNNNNNNNGC	2 cut(s)	275, 743
HpyF3I	CTNAG	3 cut(s)	41, 108, 342
Hsp92II	CATG	5 cut(s)	178, 457, 808, 824, 863
Kzo9I	GATC	2 cut(s)	37, 337
LmnI	GCTCC	1 cut(s)	292
LpnPI	CCDG	7 cut(s)	43, 146, 147, 251, 309, 354, 1006
LweI	GCATC	1 cut(s)	865
MaeI	CTAG	2 cut(s)	933, 1048
MaeIII	GTNAC	3 cut(s)	605, 632, 773
MalI	GATC	2 cut(s)	39, 339
MboI	GATC	2 cut(s)	37, 337
MhlI	GDGCHC	2 cut(s)	878, 948
MluCI	AATT	7 cut(s)	520, 617, 724, 888, 936, 952, 961
MmeI	TCCRAC	2 cut(s)	401, 571
Mph1103I	ATGCAT	1 cut(s)	822
MseI	TTAA	4 cut(s)	534, 551, 837, 939
MslI	CAYNNNNRTG	2 cut(s)	179, 458
MspI	CCGG	2 cut(s)	134, 296
MwoI	GCNNNNNNNGC	2 cut(s)	275, 743
NdeII	GATC	2 cut(s)	37, 337
NlaIII	CATG	5 cut(s)	178, 457, 808, 824, 863
NlaIV	GGNNCC	3 cut(s)	21, 132, 294
NmuCI	GTSAC	1 cut(s)	773
NsiI	ATGCAT	1 cut(s)	822
NspI	RCATGY	1 cut(s)	824
PagI	TCATGA	1 cut(s)	859
PfeI	GAWTC	3 cut(s)	424, 640, 989
PkrI	GCNGC	1 cut(s)	277
PpuMI	RGGWCCY	1 cut(s)	19
Psp5II	RGGWCCY	1 cut(s)	19
PspFI	CCCAGC	1 cut(s)	12
PspN4I	GGNNCC	3 cut(s)	21, 132, 294
PspPI	GGNCC	2 cut(s)	19, 303
PspPPI	RGGWCCY	1 cut(s)	19
RsaI	GTAC	3 cut(s)	119, 931, 1046
RsaNI	GTAC	3 cut(s)	118, 930, 1045
RseI	CAYNNNNRTG	2 cut(s)	179, 458
SaqAI	TTAA	4 cut(s)	534, 551, 837, 939
SatI	GCNGC	1 cut(s)	276
Sau3AI	GATC	2 cut(s)	37, 337
Sau96I	GGNCC	2 cut(s)	19, 303
ScaI	AGTACT	1 cut(s)	1046
SduI	GDGCHC	2 cut(s)	878, 948
SfaNI	GCATC	1 cut(s)	865
SfcI	CTRYAG	1 cut(s)	849
SinI	GGWCC	2 cut(s)	19, 303
SmiMI	CAYNNNNRTG	2 cut(s)	179, 458
Sse9I	AATT	7 cut(s)	520, 617, 724, 888, 936, 952, 961
SsiI	CCGC	6 cut(s)	55, 70, 247, 276, 451, 497
SspMI	CTAG	2 cut(s)	933, 1048
TaqI	TCGA	2 cut(s)	437, 675
TasI	AATT	7 cut(s)	520, 617, 724, 888, 936, 952, 961
TatI	WGTACW	3 cut(s)	117, 929, 1044
TauI	GCSGC	1 cut(s)	278
TfiI	GAWTC	3 cut(s)	424, 640, 989
Tru1I	TTAA	4 cut(s)	534, 551, 837, 939
Tru9I	TTAA	4 cut(s)	534, 551, 837, 939
TscAI	CASTG	2 cut(s)	422, 1000
TseFI	GTSAC	1 cut(s)	773
Tsp45I	GTSAC	1 cut(s)	773
TspDTI	ATGAA	7 cut(s)	104, 423, 540, 552, 630, 737, 986
TspRI	CASTG	2 cut(s)	422, 1000
VpaK11BI	GGWCC	2 cut(s)	19, 303
XapI	RAATTY	2 cut(s)	617, 724
XceI	RCATGY	1 cut(s)	824
XcmI	CCANNNNNNNNNTGG	1 cut(s)	820
XspI	CTAG	2 cut(s)	933, 1048
ZrmI	AGTACT	1 cut(s)	1046
Zsp2I	ATGCAT	1 cut(s)	822

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.