Rroxscaffold_3G00255810

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
50202420 .. 50207083
4664 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00255810.1

Sequence Viewer

Length: 279 bp
ATGGAGCATGACAAGCTAAAGAACACCAATAAGAACGGAGAAGAGAGGAAACCTAGGAGGGGAAGAGCCAAGAGTACTAGAAATAACGAACATGATGGTTCAAATATGAAGGAATCCAAACCTGATTGTAACGCAGAAAAAGGATATGATGAGGATCAGATCAAGAAAATGAGGGTGGAGGGAGGAAAGAGAGGAGCGGTAAGAAGAGCAACGAAGAAAGAGGTCGAAATCGCCCAAAATCGCTCAAATCCGAAATTCGTCTTCCTCGGGTTGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.58

Weight (kDa)

9.94

Isoelectric Point (pI)

31.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 197
AciI CCGC 1 cut(s) 197
AclWI GGATC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 254
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 102, 274
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
AlwI GGATC 1 cut(s) 162
Ama87I CYCGRG 1 cut(s) 266
ApoI RAATTY 1 cut(s) 254
AspA2I CCTAGG 1 cut(s) 53
AvaI CYCGRG 1 cut(s) 266
AvrII CCTAGG 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 253
BccI CCATC 1 cut(s) 89
BfaI CTAG 2 cut(s) 54, 78
BlnI CCTAGG 1 cut(s) 53
BmcAI AGTACT 1 cut(s) 76
BmeT110I CYCGRG 1 cut(s) 266
BpiI GAAGAC 1 cut(s) 253
BsaBI GATNNNNATC 1 cut(s) 153
BsaJI CCNNGG 2 cut(s) 53, 265
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 153
BseDI CCNNGG 2 cut(s) 53, 265
BseJI GATNNNNATC 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 207
BsiHKCI CYCGRG 1 cut(s) 266
BslI CCNNNNNNNGG 1 cut(s) 59
BsoBI CYCGRG 1 cut(s) 266
Bsp143I GATC 2 cut(s) 154, 159
BspACI CCGC 1 cut(s) 197
BspPI GGATC 1 cut(s) 162
BspQI GCTCTTC 2 cut(s) 58, 199
BsrBI CCGCTC 1 cut(s) 197
BssECI CCNNGG 2 cut(s) 53, 265
BssMI GATC 2 cut(s) 154, 159
BssT1I CCWWGG 1 cut(s) 53
Bst6I CTCTTC 3 cut(s) 36, 58, 199
BstKTI GATC 2 cut(s) 157, 162
BstMBI GATC 2 cut(s) 154, 159
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstV2I GAAGAC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 75
CviAII CATG 2 cut(s) 8, 92
CviJI RGCY 2 cut(s) 16, 68
CviKI_1 RGCY 2 cut(s) 16, 68
CviQI GTAC 1 cut(s) 75
DpnI GATC 2 cut(s) 156, 161
DpnII GATC 2 cut(s) 154, 159
Eam1104I CTCTTC 3 cut(s) 36, 58, 199
EarI CTCTTC 3 cut(s) 36, 58, 199
Eco130I CCWWGG 1 cut(s) 53
Eco88I CYCGRG 1 cut(s) 266
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 2 cut(s) 11, 95
FaiI YATR 4 cut(s) 9, 93, 107, 147
FatI CATG 2 cut(s) 7, 91
FspBI CTAG 2 cut(s) 54, 78
Hin1II CATG 2 cut(s) 11, 95
HinfI GANTC 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 159, 252
Hpy188III TCNNGA 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
Hsp92II CATG 2 cut(s) 11, 95
Kzo9I GATC 2 cut(s) 154, 159
LguI GCTCTTC 2 cut(s) 58, 199
LmnI GCTCC 2 cut(s) 4, 194
LpnPI CCDG 1 cut(s) 135
MaeI CTAG 2 cut(s) 54, 78
MaeIII GTNAC 1 cut(s) 128
MalI GATC 2 cut(s) 156, 161
MbiI CCGCTC 1 cut(s) 197
MboI GATC 2 cut(s) 154, 159
MboII GAAGA 5 cut(s) 53, 75, 216, 226, 253
MluCI AATT 2 cut(s) 254, 274
MnlI CCTC 9 cut(s) 39, 51, 145, 165, 172, 176, 185, 214, 275
MwoI GCNNNNNNNGC 1 cut(s) 13
NdeII GATC 2 cut(s) 154, 159
NlaIII CATG 2 cut(s) 11, 95
PciSI GCTCTTC 2 cut(s) 58, 199
PfeI GAWTC 1 cut(s) 113
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SapI GCTCTTC 2 cut(s) 58, 199
Sau3AI GATC 2 cut(s) 154, 159
ScaI AGTACT 1 cut(s) 76
SetI ASST 4 cut(s) 18, 55, 124, 225
SgeI CNNG 8 cut(s) 20, 25, 66, 82, 90, 104, 134, 175
Sse9I AATT 2 cut(s) 254, 274
SsiI CCGC 1 cut(s) 197
SspMI CTAG 2 cut(s) 54, 78
StyI CCWWGG 1 cut(s) 53
TaqI TCGA 1 cut(s) 225
TasI AATT 2 cut(s) 254, 274
TatI WGTACW 1 cut(s) 74
TfiI GAWTC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 122
TspGWI ACGGA 1 cut(s) 51
XapI RAATTY 1 cut(s) 254
XmaJI CCTAGG 1 cut(s) 53
XspI CTAG 2 cut(s) 54, 78
ZrmI AGTACT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.