Rh7AG188900

dnaJ homolog subfamily C member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0002151
Physical Location & Seq
Forward (+)
16913681 .. 16913920
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG188900.1

Sequence Viewer

Length: 240 bp
ATGGGAAATCCGGACAGCCCGTATCCTGAGGTTGTTCAGTTTTATAACTACTGGCTCAACTTTAGTTCCATAATGGATTTTTGCTGGGAGGAACCGCATGATGAGTACGATTCTGAGTCAGGTCTCCCGCAGAAGAGTAAAGCTGTGGTCCGCCTAAACATGAAAGCTAGGAAGAAGGCCAAGAAGGAGTACAACAACAAGGTGCATGCGGAGTTTGGCACACAATGCCAAGAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ zf-C2H2_jaz

Protein Analysis

79

Amino Acids

9.28

Weight (kDa)

5.61

Isoelectric Point (pI)

47.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ZUO1-like_ZHD PF21884 1 - 69 3.7e-12 Zuotin-like, zuotin homology domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 45
AccIII TCCGGA 1 cut(s) 10
AciI CCGC 4 cut(s) 95, 128, 151, 209
AfaI GTAC 2 cut(s) 107, 191
AluBI AGCT 2 cut(s) 143, 167
AluI AGCT 2 cut(s) 143, 167
Alw26I GTCTC 1 cut(s) 128
Aor13HI TCCGGA 1 cut(s) 10
AoxI GGCC 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
AxyI CCTNAGG 1 cut(s) 27
BciVI GTATCC 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 168
BfuI GTATCC 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmiI GGNNCC 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 128
BsaWI WCCGGW 1 cut(s) 10
Bse1I ACTGG 1 cut(s) 56
Bse21I CCTNAGG 1 cut(s) 27
BseAI TCCGGA 1 cut(s) 10
BseMII CTCAG 2 cut(s) 18, 105
BseNI ACTGG 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 84
BshFI GGCC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 128
BsnI GGCC 1 cut(s) 179
Bso31I GGTCTC 1 cut(s) 128
Bsp13I TCCGGA 1 cut(s) 10
BspACI CCGC 4 cut(s) 95, 128, 151, 209
BspANI GGCC 1 cut(s) 179
BspCNI CTCAG 2 cut(s) 19, 106
BspEI TCCGGA 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 93
BspTNI GGTCTC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 128
BstAPI GCANNNNNTGC 1 cut(s) 225
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 2 cut(s) 27, 114
BstMAI GTCTC 1 cut(s) 128
BstMWI GCNNNNNNNGC 1 cut(s) 225
BstNSI RCATGY 1 cut(s) 209
Bsu36I CCTNAGG 1 cut(s) 27
BsuI GTATCC 1 cut(s) 33
BsuRI GGCC 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 148
Csp6I GTAC 2 cut(s) 106, 190
CviAII CATG 3 cut(s) 98, 160, 206
CviJI RGCY 6 cut(s) 18, 55, 143, 167, 179, 236
CviKI_1 RGCY 6 cut(s) 18, 55, 143, 167, 179, 236
CviQI GTAC 2 cut(s) 106, 190
DdeI CTNAG 2 cut(s) 27, 114
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
EciI GGCGGA 1 cut(s) 140
Eco31I GGTCTC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 148
Eco81I CCTNAGG 1 cut(s) 27
FaeI CATG 3 cut(s) 101, 163, 209
FaiI YATR 5 cut(s) 45, 71, 99, 161, 207
FatI CATG 3 cut(s) 97, 159, 205
FauI CCCGC 1 cut(s) 135
FspBI CTAG 1 cut(s) 168
GsaI CCCAGC 1 cut(s) 88
HaeIII GGCC 1 cut(s) 179
HapII CCGG 1 cut(s) 11
Hin1II CATG 3 cut(s) 101, 163, 209
HinfI GANTC 2 cut(s) 110, 116
HpaII CCGG 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 11, 26
HpyAV CCTTC 2 cut(s) 169, 178
HpyCH4V TGCA 1 cut(s) 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 225
HpyF3I CTNAG 2 cut(s) 27, 114
Hsp92II CATG 3 cut(s) 101, 163, 209
Kpn2I TCCGGA 1 cut(s) 10
LpnPI CCDG 5 cut(s) 24, 37, 39, 70, 105
MaeI CTAG 1 cut(s) 168
MboII GAAGA 2 cut(s) 145, 184
MlyI GAGTC 1 cut(s) 125
MnlI CCTC 3 cut(s) 22, 82, 226
MroI TCCGGA 1 cut(s) 10
MspI CCGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 225
NlaIII CATG 3 cut(s) 101, 163, 209
NlaIV GGNNCC 1 cut(s) 93
NspI RCATGY 1 cut(s) 209
PaeI GCATGC 1 cut(s) 209
PfeI GAWTC 1 cut(s) 110
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
PsiI TTATAA 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 148
RsaI GTAC 2 cut(s) 107, 191
RsaNI GTAC 2 cut(s) 106, 190
Sau96I GGNCC 1 cut(s) 148
SchI GAGTC 1 cut(s) 125
SetI ASST 5 cut(s) 33, 124, 145, 169, 204
SinI GGWCC 1 cut(s) 148
SphI GCATGC 1 cut(s) 209
SsiI CCGC 4 cut(s) 95, 128, 151, 209
SspMI CTAG 1 cut(s) 168
TatI WGTACW 1 cut(s) 189
TfiI GAWTC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 176
VpaK11BI GGWCC 1 cut(s) 148
XceI RCATGY 1 cut(s) 209
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.