Rmu_sc0000617.1_g000021

dnaJ homolog subfamily C member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000617.1
OG0002151
Physical Location & Seq
Reverse (-)
91889 .. 92938
1050 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1050 bp
atggatttctgctgggaggacccgtatgatgagtatgatctcagtagggtcatccgcagggggtataagcggtggttgaaaaagaatatgaaggcaaggaagaaggctaagaaggagtacaacaacaaggtgccggatttggcacataatacgaagaggctggacaagagggtcatgcagatgatgatggcgaagagggaggaggaaaggaagagggagatggagaaggaaagggagaggaggaagcggttgaagaaggagaagctggcgaaggccgctatggagtatgaggagccggagtggaccaaagtggttgagaggaagagaaaatatggtgatcctgaggatgagaaggaaaaggagagagaggaatgggagtgcttggtttgtagaaaggggtttaggaatgaaaagcagtgtcggaatcacgagcagtcgaagaagcacctccgcatggttatggagttgctgaagttgaaacattatgatatggttgcggagttgattgaggtagagagaaattatgaagaacttaatgaagaagaggttttaatggaggaaaaaaggaatgaggtggtggatgatggggttggagggagtgatagtaacgaaaatgaattttctccttgtggtaacgagaatcagaaggaaaaagtcggtgaaatagttgaagtcgatgaggtggaggtggaggtggaggaggaggaggatgaggatgagatgaattttcttgaagcaatggtggcgaggcgaaaggctatggaaaaggtttgtgacgatgttcttgaaccaatgtttgaggtcatggcgaccaatatgcatgtggagaatgatgttaatgaggtggctatagagcatcatgataagctaaagagcacgaataataaaattggaggagggaagaaaccgaggaggaggagtgtggagtgtactagaattaacgagcacgataattctcctaattcaaatatgaaggaaatcaaatctgattccagtgcagaagaaaaggaaagcaaggaagaaagagaagaggtgcaaagaaagtactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ zf-C2H2_jaz

Protein Analysis

349

Amino Acids

42.01

Weight (kDa)

5.41

Isoelectric Point (pI)

60.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C2H2_jaz PF12171 125 - 149 1.7e-06 Zinc-finger double-stranded RNA-binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AccB1I GGYRCC 1 cut(s) 130
AciI CCGC 6 cut(s) 55, 70, 247, 276, 451, 497
AclWI GGATC 1 cut(s) 332
AcsI RAATTY 2 cut(s) 617, 724
AcuI CTGAAG 1 cut(s) 491
AfaI GTAC 3 cut(s) 119, 931, 1046
AfiI CCNNNNNNNGG 1 cut(s) 454
AgsI TTSAA 7 cut(s) 79, 253, 478, 671, 734, 788, 966
AluBI AGCT 2 cut(s) 265, 868
AluI AGCT 2 cut(s) 265, 868
Alw21I GWGCWC 2 cut(s) 878, 948
AlwI GGATC 1 cut(s) 332
AoxI GGCC 1 cut(s) 273
ApoI RAATTY 2 cut(s) 617, 724
AspS9I GGNCC 2 cut(s) 19, 303
AsuHPI GGTGA 2 cut(s) 347, 671
AvaII GGWCC 2 cut(s) 19, 303
AxyI CCTNAGG 1 cut(s) 342
BanI GGYRCC 1 cut(s) 130
BauI CACGAG 1 cut(s) 428
Bbv12I GWGCWC 2 cut(s) 878, 948
BccI CCATC 3 cut(s) 181, 214, 578
BcgI CGANNNNNNTGC 2 cut(s) 799, 833
BfaI CTAG 2 cut(s) 933, 1048
BfmI CTRYAG 1 cut(s) 849
BisI GCNGC 1 cut(s) 276
BlsI GCNGC 1 cut(s) 277
BmcAI AGTACT 1 cut(s) 1046
Bme18I GGWCC 2 cut(s) 19, 303
BmgT120I GGNCC 2 cut(s) 19, 303
BmiI GGNNCC 3 cut(s) 21, 132, 294
BmsI GCATC 1 cut(s) 865
BsaJI CCNNGG 1 cut(s) 908
BsaXI ACNNNNNCTCC 8 cut(s) 8, 38, 284, 314, 589, 619, 904, 934
Bsc4I CCNNNNNNNGG 1 cut(s) 454
Bse1I ACTGG 1 cut(s) 993
Bse21I CCTNAGG 1 cut(s) 342
Bse3DI GCAATG 1 cut(s) 744
BseDI CCNNGG 1 cut(s) 908
BseGI GGATG 5 cut(s) 51, 352, 586, 715, 721
BseLI CCNNNNNNNGG 1 cut(s) 454
BseMI GCAATG 1 cut(s) 744
BseMII CTCAG 2 cut(s) 55, 333
BseNI ACTGG 1 cut(s) 993
BseYI CCCAGC 1 cut(s) 12
BsgI GTGCAG 1 cut(s) 1017
BshFI GGCC 1 cut(s) 275
BshNI GGYRCC 1 cut(s) 130
BsiHKAI GWGCWC 2 cut(s) 878, 948
BsiSI CCGG 2 cut(s) 134, 296
BslI CCNNNNNNNGG 1 cut(s) 454
BsnI GGCC 1 cut(s) 275
Bsp1286I GDGCHC 2 cut(s) 878, 948
Bsp143I GATC 2 cut(s) 37, 337
BspACI CCGC 6 cut(s) 55, 70, 247, 276, 451, 497
BspANI GGCC 1 cut(s) 275
BspCNI CTCAG 2 cut(s) 54, 334
BspHI TCATGA 1 cut(s) 859
BspLI GGNNCC 3 cut(s) 21, 132, 294
BspPI GGATC 1 cut(s) 332
BspT107I GGYRCC 1 cut(s) 130
BsrDI GCAATG 1 cut(s) 744
BsrI ACTGG 1 cut(s) 993
BssECI CCNNGG 1 cut(s) 908
BssMI GATC 2 cut(s) 37, 337
BssSI CACGAG 1 cut(s) 428
Bst2BI CACGAG 1 cut(s) 428
Bst6I CTCTTC 6 cut(s) 149, 188, 206, 317, 537, 1023
BstC8I GCNNGC 1 cut(s) 267
BstDEI CTNAG 3 cut(s) 41, 108, 342
BstF5I GGATG 5 cut(s) 51, 352, 586, 715, 721
BstKTI GATC 2 cut(s) 40, 340
BstMBI GATC 2 cut(s) 37, 337
BstMWI GCNNNNNNNGC 2 cut(s) 275, 743
BstNSI RCATGY 1 cut(s) 824
BstSFI CTRYAG 1 cut(s) 849
Bsu36I CCTNAGG 1 cut(s) 342
BsuRI GGCC 1 cut(s) 275
BtsCI GGATG 5 cut(s) 51, 352, 586, 715, 721
BtsI GCAGTG 1 cut(s) 422
BtsIMutI CAGTG 2 cut(s) 422, 1000
Cac8I GCNNGC 1 cut(s) 267
CciI TCATGA 1 cut(s) 859
Cfr13I GGNCC 2 cut(s) 19, 303
Csp6I GTAC 3 cut(s) 118, 930, 1045
CviAII CATG 5 cut(s) 175, 454, 805, 821, 860
CviJI RGCY 8 cut(s) 107, 160, 265, 275, 295, 758, 848, 868
CviKI_1 RGCY 8 cut(s) 107, 160, 265, 275, 295, 758, 848, 868
CviQI GTAC 3 cut(s) 118, 930, 1045
DdeI CTNAG 3 cut(s) 41, 108, 342
DpnI GATC 2 cut(s) 39, 339
DpnII GATC 2 cut(s) 37, 337
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
Eam1104I CTCTTC 6 cut(s) 149, 188, 206, 317, 537, 1023
EarI CTCTTC 6 cut(s) 149, 188, 206, 317, 537, 1023
Eco47I GGWCC 2 cut(s) 19, 303
Eco57I CTGAAG 1 cut(s) 491
Eco81I CCTNAGG 1 cut(s) 342
EcoO109I RGGNCCY 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 822
FaeI CATG 5 cut(s) 178, 457, 808, 824, 863
FatI CATG 5 cut(s) 174, 453, 804, 820, 859
Fnu4HI GCNGC 1 cut(s) 276
FokI GGATG 5 cut(s) 38, 359, 593, 722, 728
Fsp4HI GCNGC 1 cut(s) 276
FspBI CTAG 2 cut(s) 933, 1048
GluI GCNGC 1 cut(s) 276
GsaI CCCAGC 1 cut(s) 16
HaeIII GGCC 1 cut(s) 275
HapII CCGG 2 cut(s) 134, 296
Hin1II CATG 5 cut(s) 178, 457, 808, 824, 863
HinfI GANTC 3 cut(s) 424, 640, 989
HpaII CCGG 2 cut(s) 134, 296
HphI GGTGA 2 cut(s) 347, 671
Hpy166II GTNNAC 2 cut(s) 303, 930
Hpy188I TCNGA 3 cut(s) 423, 645, 988
Hpy188III TCNNGA 5 cut(s) 341, 428, 731, 785, 860
Hpy8I GTNNAC 2 cut(s) 303, 930
HpyAV CCTTC 9 cut(s) 85, 97, 106, 220, 250, 265, 346, 640, 967
HpyCH4V TGCA 4 cut(s) 178, 820, 998, 1036
HpyF10VI GCNNNNNNNGC 2 cut(s) 275, 743
HpyF3I CTNAG 3 cut(s) 41, 108, 342
Hsp92II CATG 5 cut(s) 178, 457, 808, 824, 863
Kzo9I GATC 2 cut(s) 37, 337
LmnI GCTCC 1 cut(s) 292
LpnPI CCDG 7 cut(s) 43, 146, 147, 251, 309, 354, 1006
LweI GCATC 1 cut(s) 865
MaeI CTAG 2 cut(s) 933, 1048
MaeIII GTNAC 3 cut(s) 605, 632, 773
MalI GATC 2 cut(s) 39, 339
MboI GATC 2 cut(s) 37, 337
MhlI GDGCHC 2 cut(s) 878, 948
MluCI AATT 7 cut(s) 520, 617, 724, 888, 936, 952, 961
MmeI TCCRAC 2 cut(s) 401, 571
Mph1103I ATGCAT 1 cut(s) 822
MseI TTAA 4 cut(s) 534, 551, 837, 939
MslI CAYNNNNRTG 2 cut(s) 179, 458
MspI CCGG 2 cut(s) 134, 296
MwoI GCNNNNNNNGC 2 cut(s) 275, 743
NdeII GATC 2 cut(s) 37, 337
NlaIII CATG 5 cut(s) 178, 457, 808, 824, 863
NlaIV GGNNCC 3 cut(s) 21, 132, 294
NmuCI GTSAC 1 cut(s) 773
NsiI ATGCAT 1 cut(s) 822
NspI RCATGY 1 cut(s) 824
PagI TCATGA 1 cut(s) 859
PfeI GAWTC 3 cut(s) 424, 640, 989
PkrI GCNGC 1 cut(s) 277
PpuMI RGGWCCY 1 cut(s) 19
Psp5II RGGWCCY 1 cut(s) 19
PspFI CCCAGC 1 cut(s) 12
PspN4I GGNNCC 3 cut(s) 21, 132, 294
PspPI GGNCC 2 cut(s) 19, 303
PspPPI RGGWCCY 1 cut(s) 19
RsaI GTAC 3 cut(s) 119, 931, 1046
RsaNI GTAC 3 cut(s) 118, 930, 1045
RseI CAYNNNNRTG 2 cut(s) 179, 458
SaqAI TTAA 4 cut(s) 534, 551, 837, 939
SatI GCNGC 1 cut(s) 276
Sau3AI GATC 2 cut(s) 37, 337
Sau96I GGNCC 2 cut(s) 19, 303
ScaI AGTACT 1 cut(s) 1046
SduI GDGCHC 2 cut(s) 878, 948
SfaNI GCATC 1 cut(s) 865
SfcI CTRYAG 1 cut(s) 849
SinI GGWCC 2 cut(s) 19, 303
SmiMI CAYNNNNRTG 2 cut(s) 179, 458
Sse9I AATT 7 cut(s) 520, 617, 724, 888, 936, 952, 961
SsiI CCGC 6 cut(s) 55, 70, 247, 276, 451, 497
SspMI CTAG 2 cut(s) 933, 1048
TaqI TCGA 2 cut(s) 437, 675
TasI AATT 7 cut(s) 520, 617, 724, 888, 936, 952, 961
TatI WGTACW 3 cut(s) 117, 929, 1044
TauI GCSGC 1 cut(s) 278
TfiI GAWTC 3 cut(s) 424, 640, 989
Tru1I TTAA 4 cut(s) 534, 551, 837, 939
Tru9I TTAA 4 cut(s) 534, 551, 837, 939
TscAI CASTG 2 cut(s) 422, 1000
TseFI GTSAC 1 cut(s) 773
Tsp45I GTSAC 1 cut(s) 773
TspDTI ATGAA 7 cut(s) 104, 423, 540, 552, 630, 737, 986
TspRI CASTG 2 cut(s) 422, 1000
VpaK11BI GGWCC 2 cut(s) 19, 303
XapI RAATTY 2 cut(s) 617, 724
XceI RCATGY 1 cut(s) 824
XcmI CCANNNNNNNNNTGG 1 cut(s) 820
XspI CTAG 2 cut(s) 933, 1048
ZrmI AGTACT 1 cut(s) 1046
Zsp2I ATGCAT 1 cut(s) 822
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.