Rmu_sc0001282.1_g000027

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001282.1
Physical Location & Seq
Forward (+)
139609 .. 140091
483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001282.1_g000027.1.cds

Sequence Viewer

Length: 483 bp
atggtgaaggcagagtcgacaaagaatctgattatcaaggcgtggaggctatgcactactttacataaacaaaccagcagcaaagggtgcacagcacccagttcaaggagttgcagtactagcaatggcaagcggaagaagaacaaggccgacgaagtaactcctgtcgggtgtttctcagtctacatcggacccgaaaaacaacggtttgtggtgaaggtggagtttgctaatcatccgttgttcaaggtgctgttagaggatgcagcattggagtatgggtacaaaaatgatggtccactgttgcttccttgtgatgtggatttgttctacaatgttttggcagagatggagagcatggataacatcaatgaggaaatcataagttccaaccggtctttgatacaaattttcttcagtccaaatagcagtcatgcatcattcaaattcaagaatggacaagggttttggtggtggctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

160

Amino Acids

18.11

Weight (kDa)

8.79

Isoelectric Point (pI)

45.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 17, 183
AciI CCGC 1 cut(s) 133
AcsI RAATTY 2 cut(s) 408, 446
AcuI CTGAAG 1 cut(s) 400
AfaI GTAC 2 cut(s) 118, 284
AfiI CCNNNNNNNGG 1 cut(s) 105
AgeI ACCGGT 1 cut(s) 393
AgsI TTSAA 4 cut(s) 105, 247, 445, 451
Alw21I GWGCWC 1 cut(s) 92
Alw44I GTGCAC 1 cut(s) 88
AoxI GGCC 1 cut(s) 147
ApaLI GTGCAC 1 cut(s) 88
ApeKI GCWGC 2 cut(s) 78, 266
ApoI RAATTY 2 cut(s) 408, 446
ArsI GACNNNNNNTTYG 2 cut(s) 450, 482
AsiGI ACCGGT 1 cut(s) 393
AspS9I GGNCC 2 cut(s) 191, 296
AsuHPI GGTGA 2 cut(s) 16, 226
AvaII GGWCC 2 cut(s) 191, 296
BaeGI GKGCMC 1 cut(s) 92
Bbv12I GWGCWC 1 cut(s) 92
BbvI GCAGC 2 cut(s) 90, 278
BccI CCATC 2 cut(s) 287, 343
BfaI CTAG 1 cut(s) 120
BfmI CTRYAG 1 cut(s) 479
BisI GCNGC 2 cut(s) 79, 267
BlsI GCNGC 2 cut(s) 80, 268
BmcAI AGTACT 1 cut(s) 118
Bme18I GGWCC 2 cut(s) 191, 296
BmgT120I GGNCC 2 cut(s) 191, 296
BmiI GGNNCC 1 cut(s) 193
BmrI ACTGGG 1 cut(s) 93
BmsI GCATC 2 cut(s) 253, 446
BmuI ACTGGG 1 cut(s) 93
BsaWI WCCGGW 1 cut(s) 393
BsaXI ACNNNNNCTCC 4 cut(s) 100, 130, 266, 296
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse118I RCCGGY 1 cut(s) 393
Bse1I ACTGG 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 130
BseGI GGATG 2 cut(s) 235, 268
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 99
BseSI GKGCMC 1 cut(s) 92
BseXI GCAGC 2 cut(s) 90, 278
BshFI GGCC 1 cut(s) 149
BshTI ACCGGT 1 cut(s) 393
BsiHKAI GWGCWC 1 cut(s) 92
BsiSI CCGG 1 cut(s) 394
BslI CCNNNNNNNGG 1 cut(s) 105
BsnI GGCC 1 cut(s) 149
Bsp1286I GDGCHC 1 cut(s) 92
BspACI CCGC 1 cut(s) 133
BspANI GGCC 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 191
BspLI GGNNCC 1 cut(s) 193
BsrDI GCAATG 1 cut(s) 130
BsrFI RCCGGY 1 cut(s) 393
BsrI ACTGG 1 cut(s) 99
BssAI RCCGGY 1 cut(s) 393
Bst4CI ACNGT 2 cut(s) 207, 303
BstAPI GCANNNNNTGC 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 178
BstF5I GGATG 2 cut(s) 235, 268
BstMWI GCNNNNNNNGC 2 cut(s) 87, 120
BstSFI CTRYAG 1 cut(s) 479
BstSLI GKGCMC 1 cut(s) 92
BstV1I GCAGC 2 cut(s) 90, 278
BsuRI GGCC 1 cut(s) 149
BtsCI GGATG 2 cut(s) 235, 268
BtsIMutI CAGTG 1 cut(s) 299
Cac8I GCNNGC 1 cut(s) 131
Cfr10I RCCGGY 1 cut(s) 393
Cfr13I GGNCC 2 cut(s) 191, 296
Csp6I GTAC 2 cut(s) 117, 283
CspAI ACCGGT 1 cut(s) 393
CviAII CATG 2 cut(s) 358, 434
CviJI RGCY 3 cut(s) 49, 149, 478
CviKI_1 RGCY 3 cut(s) 49, 149, 478
CviQI GTAC 2 cut(s) 117, 283
DdeI CTNAG 1 cut(s) 178
Eco47I GGWCC 2 cut(s) 191, 296
Eco57I CTGAAG 1 cut(s) 400
EcoT22I ATGCAT 1 cut(s) 439
FaeI CATG 2 cut(s) 361, 437
FaiI YATR 7 cut(s) 52, 66, 279, 359, 383, 435, 481
FatI CATG 2 cut(s) 357, 433
FblI GTMKAC 2 cut(s) 17, 183
Fnu4HI GCNGC 2 cut(s) 79, 267
FokI GGATG 2 cut(s) 222, 275
Fsp4HI GCNGC 2 cut(s) 79, 267
FspBI CTAG 1 cut(s) 120
GluI GCNGC 2 cut(s) 79, 267
HaeIII GGCC 1 cut(s) 149
HapII CCGG 1 cut(s) 394
Hin1II CATG 2 cut(s) 361, 437
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HinfI GANTC 2 cut(s) 14, 25
HpaII CCGG 1 cut(s) 394
HphI GGTGA 2 cut(s) 16, 226
Hpy166II GTNNAC 4 cut(s) 18, 90, 184, 299
Hpy188I TCNGA 2 cut(s) 30, 191
Hpy188III TCNNGA 1 cut(s) 451
Hpy8I GTNNAC 4 cut(s) 18, 90, 184, 299
Hpy99I CGWCG 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 211
HpyCH4III ACNGT 2 cut(s) 207, 303
HpyCH4V TGCA 5 cut(s) 54, 90, 114, 266, 437
HpyF10VI GCNNNNNNNGC 2 cut(s) 87, 120
HpyF3I CTNAG 1 cut(s) 178
Hsp92II CATG 2 cut(s) 361, 437
LpnPI CCDG 4 cut(s) 88, 112, 177, 407
Lsp1109I GCAGC 2 cut(s) 90, 278
LweI GCATC 2 cut(s) 253, 446
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 157
MboII GAAGA 3 cut(s) 148, 151, 406
MhlI GDGCHC 1 cut(s) 92
MluCI AATT 2 cut(s) 408, 446
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 1 cut(s) 414
MnlI CCTC 3 cut(s) 39, 253, 367
Mph1103I ATGCAT 1 cut(s) 439
MspI CCGG 1 cut(s) 394
MwoI GCNNNNNNNGC 2 cut(s) 87, 120
NlaIII CATG 2 cut(s) 361, 437
NlaIV GGNNCC 1 cut(s) 193
NsiI ATGCAT 1 cut(s) 439
PfeI GAWTC 1 cut(s) 25
PinAI ACCGGT 1 cut(s) 393
PkrI GCNGC 2 cut(s) 80, 268
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 193
PspPI GGNCC 2 cut(s) 191, 296
RsaI GTAC 2 cut(s) 118, 284
RsaNI GTAC 2 cut(s) 117, 283
SalI GTCGAC 1 cut(s) 16
SatI GCNGC 2 cut(s) 79, 267
Sau96I GGNCC 2 cut(s) 191, 296
ScaI AGTACT 1 cut(s) 118
SchI GAGTC 1 cut(s) 23
SduI GDGCHC 1 cut(s) 92
SetI ASST 2 cut(s) 222, 252
SfaNI GCATC 2 cut(s) 253, 446
SfcI CTRYAG 1 cut(s) 479
SinI GGWCC 2 cut(s) 191, 296
Sse9I AATT 2 cut(s) 408, 446
SsiI CCGC 1 cut(s) 133
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 2 cut(s) 207, 303
TaqI TCGA 1 cut(s) 17
TasI AATT 2 cut(s) 408, 446
TatI WGTACW 1 cut(s) 116
TfiI GAWTC 1 cut(s) 25
TscAI CASTG 1 cut(s) 306
TseI GCWGC 2 cut(s) 78, 266
TspGWI ACGGA 1 cut(s) 228
TspRI CASTG 1 cut(s) 306
VneI GTGCAC 1 cut(s) 88
VpaK11BI GGWCC 2 cut(s) 191, 296
XapI RAATTY 2 cut(s) 408, 446
XmiI GTMKAC 2 cut(s) 17, 183
XspI CTAG 1 cut(s) 120
ZrmI AGTACT 1 cut(s) 118
Zsp2I ATGCAT 1 cut(s) 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.