Rmu_sc0001299.1_g000004

CCR4-associated factor 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001299.1
Physical Location & Seq
Forward (+)
24041 .. 24798
758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001299.1_g000004.1.cds

Sequence Viewer

Length: 291 bp
atggcaacgtctgttactgcacgtgacttgcacactgctggtgcaactgacccgacggtgcatggaatcctctccggttgggaccttgatttgacgcaagtcctaggtagtggcaaaggcaagtttttgaatagtgtctcgattgatgtcctgaagcggcagggaatagacttttccgacaacaaatgcactggtatttgttttgcagactttgctgaggagattgagaggtctgggctagtggagttgcttccttgcttgacttgggctacctttccagagtgcatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.32

Weight (kDa)

4.57

Isoelectric Point (pI)

35.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 157
AcuI CTGAAG 1 cut(s) 173
AcvI CACGTG 1 cut(s) 23
AgsI TTSAA 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 142
AspA2I CCTAGG 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 82
AvaII GGWCC 1 cut(s) 82
AvrII CCTAGG 1 cut(s) 103
BbrPI CACGTG 1 cut(s) 23
BbvCI CCTCAGC 1 cut(s) 216
BcoDI GTCTC 1 cut(s) 142
BfaI CTAG 2 cut(s) 104, 239
BisI GCNGC 1 cut(s) 158
BlnI CCTAGG 1 cut(s) 103
BlsI GCNGC 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 83
BoxI GACNNNNGTC 1 cut(s) 98
Bpu10I CCTNAGC 1 cut(s) 216
BsaAI YACGTR 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 103
BsaWI WCCGGW 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 196
BseDI CCNNGG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 196
BseRI GAGGAG 1 cut(s) 233
BsiSI CCGG 1 cut(s) 75
BslFI GGGAC 1 cut(s) 95
BsmAI GTCTC 1 cut(s) 142
BsmFI GGGAC 1 cut(s) 95
BspACI CCGC 1 cut(s) 157
BspCNI CTCAG 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 83
BsrI ACTGG 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 58
BstAPI GCANNNNNTGC 1 cut(s) 212
BstBAI YACGTR 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 216
BstMAI GTCTC 1 cut(s) 142
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstPAI GACNNNNGTC 1 cut(s) 98
BtsI GCAGTG 1 cut(s) 33
BtsIMutI CAGTG 2 cut(s) 33, 189
Cfr13I GGNCC 1 cut(s) 82
CseI GACGC 1 cut(s) 103
CviAII CATG 1 cut(s) 62
CviJI RGCY 2 cut(s) 238, 269
CviKI_1 RGCY 2 cut(s) 238, 269
DdeI CTNAG 1 cut(s) 216
Eco130I CCWWGG 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 173
Eco72I CACGTG 1 cut(s) 23
EcoO109I RGGNCCY 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 1 cut(s) 65
FaiI YATR 3 cut(s) 63, 287, 289
FaqI GGGAC 1 cut(s) 95
FatI CATG 1 cut(s) 61
FauNDI CATATG 1 cut(s) 287
Fnu4HI GCNGC 1 cut(s) 158
Fsp4HI GCNGC 1 cut(s) 158
FspBI CTAG 2 cut(s) 104, 239
GluI GCNGC 1 cut(s) 158
HapII CCGG 1 cut(s) 75
HgaI GACGC 1 cut(s) 103
Hin1II CATG 1 cut(s) 65
HinfI GANTC 1 cut(s) 66
HpaII CCGG 1 cut(s) 75
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 3 cut(s) 139, 151, 278
Hpy99I CGWCG 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4IV ACGT 2 cut(s) 8, 22
HpyCH4V TGCA 7 cut(s) 20, 31, 44, 61, 189, 206, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 216
HpySE526I ACGT 2 cut(s) 8, 22
Hsp92II CATG 1 cut(s) 65
LpnPI CCDG 6 cut(s) 24, 88, 146, 164, 177, 219
MaeI CTAG 2 cut(s) 104, 239
MaeII ACGT 2 cut(s) 8, 22
MaeIII GTNAC 2 cut(s) 13, 23
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 3 cut(s) 80, 211, 222
MspI CCGG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeI CATATG 1 cut(s) 287
NlaIII CATG 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 66
PkrI GCNGC 1 cut(s) 159
PmaCI CACGTG 1 cut(s) 23
PmlI CACGTG 1 cut(s) 23
Ppu21I YACGTR 1 cut(s) 23
PpuMI RGGWCCY 1 cut(s) 82
PshAI GACNNNNGTC 1 cut(s) 98
Psp5II RGGWCCY 1 cut(s) 82
PspCI CACGTG 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 83
PspPI GGNCC 1 cut(s) 82
PspPPI RGGWCCY 1 cut(s) 82
SatI GCNGC 1 cut(s) 158
Sau96I GGNCC 1 cut(s) 82
SetI ASST 6 cut(s) 11, 25, 87, 109, 233, 275
SinI GGWCC 1 cut(s) 82
SsiI CCGC 1 cut(s) 157
SspMI CTAG 2 cut(s) 104, 239
StyI CCWWGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 58
TaiI ACGT 2 cut(s) 11, 25
TaqI TCGA 1 cut(s) 140
TauI GCSGC 1 cut(s) 160
TfiI GAWTC 1 cut(s) 66
TscAI CASTG 2 cut(s) 40, 196
TseFI GTSAC 1 cut(s) 23
Tsp45I GTSAC 1 cut(s) 23
TspRI CASTG 2 cut(s) 40, 196
VpaK11BI GGWCC 1 cut(s) 82
XmaJI CCTAGG 1 cut(s) 103
XspI CTAG 2 cut(s) 104, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.