Rorug02G0302000

CCR4-associated factor 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
33710554 .. 33711394
841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0302000.1

Sequence Viewer

Length: 252 bp
ATGGGTTTTCGATTACCTGGAATTGCTAGCACAAAGACATCAGATATCCCAAAAGGCTACTTTGCAGTCTATGTTGGAGAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAGTCAAGCTGAAGAAGAATTTGGATACCATCATCCAATGGGCGGTATCACAATTCCTTGCAGTGAAGACACCTTCATTGATCTCACTTCCCGCTTAAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.27

Weight (kDa)

5.51

Isoelectric Point (pI)

35.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 10 - 80 5.4e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 189, 238
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 188
AflII CTTAAG 1 cut(s) 241
AgsI TTSAA 1 cut(s) 121
AjnI CCWGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 4 cut(s) 117, 149, 150, 182
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
ApoI RAATTY 1 cut(s) 164
AsuNHI GCTAGC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 219
BccI CCATC 1 cut(s) 183
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 1 cut(s) 164
BfaI CTAG 1 cut(s) 27
BfrI CTTAAG 1 cut(s) 241
BfuI GTATCC 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 18
BmtI GCTAGC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 219
Bsc4I CCNNNNNNNGG 1 cut(s) 188
BseBI CCWGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 188
Bsp143I GATC 1 cut(s) 226
BspACI CCGC 2 cut(s) 189, 238
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 105
BspOI GCTAGC 1 cut(s) 30
BspTI CTTAAG 1 cut(s) 241
BssMI GATC 1 cut(s) 226
Bst2UI CCWGG 1 cut(s) 18
BstAFI CTTAAG 1 cut(s) 241
BstC8I GCNNGC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 219
BsuI GTATCC 1 cut(s) 164
BtsCI GGATG 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 214
Cac8I GCNNGC 1 cut(s) 28
CviJI RGCY 3 cut(s) 57, 84, 155
CviKI_1 RGCY 3 cut(s) 57, 84, 155
DdeI CTNAG 1 cut(s) 146
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 16
EcoRV GATATC 1 cut(s) 46
FaiI YATR 2 cut(s) 72, 115
FauI CCCGC 1 cut(s) 245
FokI GGATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 27
HinfI GANTC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 65, 207
HpyF3I CTNAG 1 cut(s) 146
Kzo9I GATC 1 cut(s) 226
LpnPI CCDG 4 cut(s) 3, 30, 98, 122
MaeI CTAG 1 cut(s) 27
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 4 cut(s) 100, 170, 173, 224
MluCI AATT 3 cut(s) 21, 164, 198
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 55
MseI TTAA 1 cut(s) 242
MspCI CTTAAG 1 cut(s) 241
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NdeII GATC 1 cut(s) 226
NheI GCTAGC 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 105
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 242
Sau3AI GATC 1 cut(s) 226
SchI GAGTC 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 18
SetI ASST 4 cut(s) 19, 130, 157, 221
SgeI CNNG 7 cut(s) 29, 30, 39, 97, 149, 164, 216
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 3 cut(s) 21, 164, 198
SsiI CCGC 2 cut(s) 189, 238
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 16
TaqI TCGA 1 cut(s) 10
TasI AATT 3 cut(s) 21, 164, 198
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 211
TspRI CASTG 1 cut(s) 214
Vha464I CTTAAG 1 cut(s) 241
XapI RAATTY 1 cut(s) 164
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.