Rmu_sc0009573.1_g000011

Xyloglucan galactosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009573.1
Physical Location & Seq
Forward (+)
27973 .. 29457
1485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009573.1_g000011.1.cds

Sequence Viewer

Length: 1485 bp
atggagaatccactcatagctaagtgctctcaggacctctggtttggcatactcatctccttctttttttgctttgtattgctttcatttgattattcaactttcttgggtgtcaacaatggtgccaatcttttactgaataaacgaggtcgcccagttgggtttgtgaagaaccaaaccgttttgattacttcccagtctagcccagattcttgtattggtcggtatgtttatgtacatgatgatcttccttccaagttcaactctgatttgctcaagaactgtaggcttcttactagagggactgacaagcccaatctgtgtccttactttgagaattggggttttggtcctgaaattgaaaacacggaaggggttttagccaacaagagttggttctccacaaaccagttcactttagaagtcatattccataacaagatgaagcagtataagtgtttgacaaaaaactcatctctggcttcagccatttatgtgccattctatgctggccttgatgccagtctccatttgtgggattccaatctcacggtgagagacgcttcggctagagatctcaatggttggctttcgaagaggcccgaatggaagacgatgtgggggagagaccatttcttggttgcagggaggatttcgtgggatttcaggaggcaaacggatgaggtttcggattgggggagtaaactcaggttcttgccggaagcgatgaacatgagtatgttgtcagttgaaggaagttcatggagaaatgactatgccattccatacccaacaaactttcatcctgcaaaggatagcgacgtagttcaatggcagaacagaatgcgaaaactagagaggccttacttgttcacttttgttggtgctccaaggcctgaccagcaaaactcgattcgggggaagattattgatcagtgcctagcttcaagtgtttgcaagttgatagattgcagttctggtgggattaagtgtgacaacccggctagtgttatgagggtgtttcagagctcagtttattgcttgcaacctacaggggattcatacactaggaaatcagcttttgactcgattctggcgggttgtattccggttttctttcatccgggtactgcttattcgcaatatttgtggcacttacctaagaatcataccaagtattcggtgtttattccggtgaggtatgtagaagatttgaaagaaggcctcattgagagaaccttggttggaatttcaaaggagaaagaattggaaatgagagaagaggttataaggctaataccgaagctggtgtatgcagatcccatgtcaagattagagaccgaagatgcatttgatttatctgtcaggggaattcttgagacgatagagaatgttaggaaggtgattagagaaggaagggatcctagcattggttttgcagatgaggatagttacaagtacacatttccaaagacattagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

494

Amino Acids

56.62

Weight (kDa)

7.89

Isoelectric Point (pI)

40.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1289
AccB1I GGYRCC 1 cut(s) 122
AccB7I CCANNNNNTGG 1 cut(s) 637
AciI CCGC 1 cut(s) 1097
AclWI GGATC 3 cut(s) 1313, 1415, 1428
AcsI RAATTY 2 cut(s) 1248, 1371
AcuI CTGAAG 1 cut(s) 468
AfaI GTAC 3 cut(s) 237, 1129, 1460
AfiI CCNNNNNNNGG 3 cut(s) 535, 637, 1430
AgsI TTSAA 8 cut(s) 99, 262, 362, 752, 830, 948, 1216, 1254
AluBI AGCT 5 cut(s) 20, 944, 1029, 1079, 1306
AluI AGCT 5 cut(s) 20, 944, 1029, 1079, 1306
Alw21I GWGCWC 3 cut(s) 29, 889, 1031
Alw26I GTCTC 5 cut(s) 530, 552, 621, 1331, 1373
AlwI GGATC 3 cut(s) 1313, 1415, 1428
AoxI GGCC 5 cut(s) 511, 599, 860, 893, 1222
ApoI RAATTY 2 cut(s) 1248, 1371
ArsI GACNNNNNNTTYG 2 cut(s) 26, 58
AspS9I GGNCC 3 cut(s) 34, 350, 600
AsuC2I CCSGG 2 cut(s) 1001, 1125
AsuHPI GGTGA 3 cut(s) 565, 1207, 1414
AsuII TTCGAA 1 cut(s) 593
AvaII GGWCC 2 cut(s) 34, 350
BamHI GGATCC 1 cut(s) 1420
BanI GGYRCC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 1031
BbsI GAAGAC 1 cut(s) 617
Bbv12I GWGCWC 3 cut(s) 29, 889, 1031
BclI TGATCA 1 cut(s) 931
BcnI CCSGG 2 cut(s) 1001, 1125
BcoDI GTCTC 5 cut(s) 530, 552, 621, 1331, 1373
BfaI CTAG 8 cut(s) 201, 297, 570, 854, 941, 1005, 1068, 1425
BfmI CTRYAG 2 cut(s) 283, 1050
BglII AGATCT 1 cut(s) 574
Bme1390I CCNGG 2 cut(s) 1001, 1125
Bme18I GGWCC 2 cut(s) 34, 350
BmgT120I GGNCC 3 cut(s) 34, 350, 600
BmiI GGNNCC 2 cut(s) 124, 1422
BmrFI CCNGG 2 cut(s) 1001, 1125
BmrI ACTGGG 2 cut(s) 149, 190
BmsI GCATC 2 cut(s) 508, 1336
BmuI ACTGGG 2 cut(s) 149, 190
BpiI GAAGAC 1 cut(s) 617
Bpu14I TTCGAA 1 cut(s) 593
BpuEI CTTGAG 2 cut(s) 260, 1397
BpuMI CCSGG 2 cut(s) 1001, 1125
BsaBI GATNNNNATC 1 cut(s) 543
BsaI GGTCTC 2 cut(s) 621, 1331
BsaJI CCNNGG 2 cut(s) 890, 1239
BsaWI WCCGGW 2 cut(s) 1108, 1192
Bsc4I CCNNNNNNNGG 3 cut(s) 535, 637, 1430
Bse1I ACTGG 4 cut(s) 155, 196, 409, 522
Bse8I GATNNNNATC 1 cut(s) 543
BseDI CCNNGG 2 cut(s) 890, 1239
BseGI GGATG 3 cut(s) 685, 802, 1120
BseJI GATNNNNATC 1 cut(s) 543
BseLI CCNNNNNNNGG 3 cut(s) 535, 637, 1430
BseMII CTCAG 3 cut(s) 44, 721, 1044
BseNI ACTGG 4 cut(s) 155, 196, 409, 522
BshFI GGCC 5 cut(s) 513, 601, 862, 895, 1224
BshNI GGYRCC 1 cut(s) 122
BsiHKAI GWGCWC 3 cut(s) 29, 889, 1031
BsiSI CCGG 5 cut(s) 719, 1001, 1109, 1124, 1193
BslFI GGGAC 1 cut(s) 316
BslI CCNNNNNNNGG 3 cut(s) 535, 637, 1430
BsmAI GTCTC 5 cut(s) 530, 552, 621, 1331, 1373
BsmBI CGTCTC 2 cut(s) 552, 1373
BsmFI GGGAC 1 cut(s) 316
BsmI GAATGC 1 cut(s) 849
BsnI GGCC 5 cut(s) 513, 601, 862, 895, 1224
Bso31I GGTCTC 2 cut(s) 621, 1331
Bsp119I TTCGAA 1 cut(s) 593
Bsp1286I GDGCHC 3 cut(s) 29, 889, 1031
Bsp1407I TGTACA 1 cut(s) 235
Bsp143I GATC 5 cut(s) 244, 574, 931, 1318, 1420
BspACI CCGC 1 cut(s) 1097
BspANI GGCC 5 cut(s) 513, 601, 862, 895, 1224
BspCNI CTCAG 3 cut(s) 43, 720, 1043
BspLI GGNNCC 2 cut(s) 124, 1422
BspPI GGATC 3 cut(s) 1313, 1415, 1428
BspT104I TTCGAA 1 cut(s) 593
BspT107I GGYRCC 1 cut(s) 122
BspTNI GGTCTC 2 cut(s) 621, 1331
BsrGI TGTACA 1 cut(s) 235
BsrI ACTGG 4 cut(s) 155, 196, 409, 522
BssECI CCNNGG 2 cut(s) 890, 1239
BssMI GATC 5 cut(s) 244, 574, 931, 1318, 1420
BssT1I CCWWGG 2 cut(s) 890, 1239
Bst4CI ACNGT 3 cut(s) 181, 284, 553
Bst6I CTCTTC 2 cut(s) 590, 1275
BstAUI TGTACA 1 cut(s) 235
BstBI TTCGAA 1 cut(s) 593
BstC8I GCNNGC 2 cut(s) 511, 1043
BstDEI CTNAG 5 cut(s) 21, 30, 707, 1030, 1161
BstF5I GGATG 3 cut(s) 685, 802, 1120
BstKTI GATC 5 cut(s) 247, 577, 934, 1321, 1423
BstMAI GTCTC 5 cut(s) 530, 552, 621, 1331, 1373
BstMBI GATC 5 cut(s) 244, 574, 931, 1318, 1420
BstMWI GCNNNNNNNGC 1 cut(s) 901
BstSCI CCNGG 2 cut(s) 999, 1123
BstSFI CTRYAG 2 cut(s) 283, 1050
BstV2I GAAGAC 1 cut(s) 617
BstX2I RGATCY 3 cut(s) 574, 1318, 1420
BstYI RGATCY 3 cut(s) 574, 1318, 1420
BsuRI GGCC 5 cut(s) 513, 601, 862, 895, 1224
BtgZI GCGATG 1 cut(s) 740
BtsCI GGATG 3 cut(s) 685, 802, 1120
BtsIMutI CAGTG 1 cut(s) 941
Cac8I GCNNGC 2 cut(s) 511, 1043
Cfr13I GGNCC 3 cut(s) 34, 350, 600
CseI GACGC 1 cut(s) 569
Csp6I GTAC 3 cut(s) 236, 1128, 1459
CspCI CAANNNNNGTGG 2 cut(s) 1130, 1165
CviAII CATG 4 cut(s) 239, 733, 762, 1324
CviQI GTAC 3 cut(s) 236, 1128, 1459
DdeI CTNAG 5 cut(s) 21, 30, 707, 1030, 1161
DpnI GATC 5 cut(s) 246, 576, 933, 1320, 1422
DpnII GATC 5 cut(s) 244, 574, 931, 1318, 1420
Eam1104I CTCTTC 2 cut(s) 590, 1275
EarI CTCTTC 2 cut(s) 590, 1275
Ecl136II GAGCTC 1 cut(s) 1029
Eco130I CCWWGG 2 cut(s) 890, 1239
Eco147I AGGCCT 3 cut(s) 862, 895, 1224
Eco24I GRGCYC 1 cut(s) 1031
Eco31I GGTCTC 2 cut(s) 621, 1331
Eco47I GGWCC 2 cut(s) 34, 350
Eco53kI GAGCTC 1 cut(s) 1029
Eco57I CTGAAG 1 cut(s) 468
EcoICRI GAGCTC 1 cut(s) 1029
EcoO109I RGGNCCY 1 cut(s) 34
EcoRI GAATTC 1 cut(s) 1371
EcoT14I CCWWGG 2 cut(s) 890, 1239
EcoT22I ATGCAT 1 cut(s) 1351
EcoT38I GRGCYC 1 cut(s) 1031
ErhI CCWWGG 2 cut(s) 890, 1239
Esp3I CGTCTC 2 cut(s) 552, 1373
FaeI CATG 4 cut(s) 242, 736, 765, 1327
FaqI GGGAC 1 cut(s) 316
FatI CATG 4 cut(s) 238, 732, 761, 1323
FauI CCCGC 1 cut(s) 1090
FbaI TGATCA 1 cut(s) 931
FokI GGATG 3 cut(s) 692, 789, 1107
FriOI GRGCYC 1 cut(s) 1031
FspBI CTAG 8 cut(s) 201, 297, 570, 854, 941, 1005, 1068, 1425
HaeIII GGCC 5 cut(s) 513, 601, 862, 895, 1224
HapII CCGG 5 cut(s) 719, 1001, 1109, 1124, 1193
HgaI GACGC 1 cut(s) 569
Hin1II CATG 4 cut(s) 242, 736, 765, 1327
HincII GTYRAC 1 cut(s) 115
HindII GTYRAC 1 cut(s) 115
HinfI GANTC 8 cut(s) 7, 209, 539, 913, 1058, 1085, 1090, 1165
HpaII CCGG 5 cut(s) 719, 1001, 1109, 1124, 1193
HphI GGTGA 3 cut(s) 565, 1207, 1414
Hpy166II GTNNAC 5 cut(s) 115, 414, 704, 873, 1461
Hpy188I TCNGA 3 cut(s) 268, 691, 1026
Hpy188III TCNNGA 6 cut(s) 32, 277, 353, 667, 1329, 1376
Hpy8I GTNNAC 5 cut(s) 115, 414, 704, 873, 1461
Hpy99I CGWCG 1 cut(s) 824
HpyAV CCTTC 8 cut(s) 70, 261, 365, 746, 1214, 1393, 1406, 1410
HpyCH4III ACNGT 3 cut(s) 181, 284, 553
HpyCH4IV ACGT 1 cut(s) 822
HpyCH4V TGCA 8 cut(s) 644, 809, 957, 972, 1045, 1316, 1349, 1439
HpyF10VI GCNNNNNNNGC 1 cut(s) 901
HpyF3I CTNAG 5 cut(s) 21, 30, 707, 1030, 1161
HpySE526I ACGT 1 cut(s) 822
Hsp92II CATG 4 cut(s) 242, 736, 765, 1327
Ksp22I TGATCA 1 cut(s) 931
Kzo9I GATC 5 cut(s) 244, 574, 931, 1318, 1420
LmnI GCTCC 1 cut(s) 892
LweI GCATC 2 cut(s) 508, 1336
MaeI CTAG 8 cut(s) 201, 297, 570, 854, 941, 1005, 1068, 1425
MaeII ACGT 1 cut(s) 822
MaeIII GTNAC 2 cut(s) 992, 1451
MalI GATC 5 cut(s) 246, 576, 933, 1320, 1422
MboI GATC 5 cut(s) 244, 574, 931, 1318, 1420
MboII GAAGA 8 cut(s) 181, 239, 607, 622, 934, 1220, 1292, 1355
MflI RGATCY 3 cut(s) 574, 1318, 1420
MhlI GDGCHC 3 cut(s) 29, 889, 1031
MluCI AATT 5 cut(s) 337, 357, 1248, 1265, 1371
MlyI GAGTC 1 cut(s) 1079
MmeI TCCRAC 1 cut(s) 1225
Mph1103I ATGCAT 1 cut(s) 1351
MseI TTAA 1 cut(s) 987
MslI CAYNNNNRTG 2 cut(s) 494, 737
MspI CCGG 5 cut(s) 719, 1001, 1109, 1124, 1193
MspR9I CCNGG 2 cut(s) 1001, 1125
Mva1269I GAATGC 1 cut(s) 849
MwoI GCNNNNNNNGC 1 cut(s) 901
NciI CCSGG 2 cut(s) 1001, 1125
NdeII GATC 5 cut(s) 244, 574, 931, 1318, 1420
NlaIII CATG 4 cut(s) 242, 736, 765, 1327
NlaIV GGNNCC 2 cut(s) 124, 1422
NmuCI GTSAC 1 cut(s) 992
NsiI ATGCAT 1 cut(s) 1351
NspV TTCGAA 1 cut(s) 593
PceI AGGCCT 3 cut(s) 862, 895, 1224
PctI GAATGC 1 cut(s) 849
PfeI GAWTC 7 cut(s) 7, 209, 539, 913, 1058, 1090, 1165
PflMI CCANNNNNTGG 1 cut(s) 637
PleI GAGTC 1 cut(s) 1079
PpsI GAGTC 1 cut(s) 1079
PpuMI RGGWCCY 1 cut(s) 34
PsiI TTATAA 1 cut(s) 1289
Psp124BI GAGCTC 1 cut(s) 1031
Psp5II RGGWCCY 1 cut(s) 34
PspN4I GGNNCC 2 cut(s) 124, 1422
PspPI GGNCC 3 cut(s) 34, 350, 600
PspPPI RGGWCCY 1 cut(s) 34
PsuI RGATCY 3 cut(s) 574, 1318, 1420
RsaI GTAC 3 cut(s) 237, 1129, 1460
RsaNI GTAC 3 cut(s) 236, 1128, 1459
RseI CAYNNNNRTG 2 cut(s) 494, 737
SacI GAGCTC 1 cut(s) 1031
SaqAI TTAA 1 cut(s) 987
Sau3AI GATC 5 cut(s) 244, 574, 931, 1318, 1420
Sau96I GGNCC 3 cut(s) 34, 350, 600
SchI GAGTC 1 cut(s) 1079
ScrFI CCNGG 2 cut(s) 1001, 1125
SduI GDGCHC 3 cut(s) 29, 889, 1031
SfaNI GCATC 2 cut(s) 508, 1336
SfcI CTRYAG 2 cut(s) 283, 1050
SfuI TTCGAA 1 cut(s) 593
SinI GGWCC 2 cut(s) 34, 350
SmiMI CAYNNNNRTG 2 cut(s) 494, 737
SmlI CTYRAG 2 cut(s) 275, 1376
SmoI CTYRAG 2 cut(s) 275, 1376
Sse9I AATT 5 cut(s) 337, 357, 1248, 1265, 1371
SseBI AGGCCT 3 cut(s) 862, 895, 1224
SsiI CCGC 1 cut(s) 1097
SspI AATATT 1 cut(s) 1145
SspMI CTAG 8 cut(s) 201, 297, 570, 854, 941, 1005, 1068, 1425
SstI GAGCTC 1 cut(s) 1031
StuI AGGCCT 3 cut(s) 862, 895, 1224
StyD4I CCNGG 2 cut(s) 999, 1123
StyI CCWWGG 2 cut(s) 890, 1239
TaaI ACNGT 3 cut(s) 181, 284, 553
TaiI ACGT 1 cut(s) 825
TaqI TCGA 3 cut(s) 593, 911, 1088
TaqII GACCGA 1 cut(s) 1355
TasI AATT 5 cut(s) 337, 357, 1248, 1265, 1371
TatI WGTACW 2 cut(s) 235, 1458
TfiI GAWTC 7 cut(s) 7, 209, 539, 913, 1058, 1090, 1165
Tru1I TTAA 1 cut(s) 987
Tru9I TTAA 1 cut(s) 987
TscAI CASTG 1 cut(s) 941
TseFI GTSAC 1 cut(s) 992
Tsp45I GTSAC 1 cut(s) 992
TspDTI ATGAA 7 cut(s) 75, 458, 743, 750, 791, 1050, 1109
TspGWI ACGGA 2 cut(s) 383, 692
TspRI CASTG 1 cut(s) 941
Van91I CCANNNNNTGG 1 cut(s) 637
VpaK11BI GGWCC 2 cut(s) 34, 350
XapI RAATTY 2 cut(s) 1248, 1371
XspI CTAG 8 cut(s) 201, 297, 570, 854, 941, 1005, 1068, 1425
Zsp2I ATGCAT 1 cut(s) 1351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.