Rmu_sc0010556.1_g000001

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010556.1
Physical Location & Seq
Forward (+)
1 .. 2540
2540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010556.1_g000001.1.cds

Sequence Viewer

Length: 613 bp
gagatgtctgtcgtttgcagaaactgtgccggttagaattgtgaacagacaatgttcatctaggcttcaagcagttgctgatgtagctgcttctataagagcagggttttatgacattggtattggagctgggttggaatccatgactgtaaacccaatggcatgggaaggggatgtaaagatctttgaacaagcccagaattgccttcttcctatgggggtcaccttggaaaatgttgctcatcattttggtgtttcaaggcaggagcaagatcaggcttcagtttactctcatagaaaggcagctgctgctactgctgctactgctgctggtagatttaaagatgaaattatccctgtggcaaccaagattgttgatccaaaatctggtgatgagaaacctgttacaatctccgttgatgatgggattcgaaacacaacattgtcggacctagcaaagctgaagcctgtgtttaagaaagatgggaccaccactactggtaattctagtcaagttagtgatggtgctagagctgttctcttgatgaagagaagtgttgccgaccaaaaaggaattccaattcttggtgtattcaggtatgctgctccgtga
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

21.65

Weight (kDa)

8.8

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 387, 585
AclWI GGATC 1 cut(s) 372
AcsI RAATTY 1 cut(s) 574
AcuI CTGAAG 2 cut(s) 265, 483
AfiI CCNNNNNNNGG 2 cut(s) 387, 585
AgsI TTSAA 3 cut(s) 69, 189, 259
AjuI GAANNNNNNNTTGG 2 cut(s) 559, 591
AluBI AGCT 5 cut(s) 87, 129, 306, 461, 534
AluI AGCT 5 cut(s) 87, 129, 306, 461, 534
AlwI GGATC 1 cut(s) 372
AlwNI CAGNNNCTG 3 cut(s) 24, 78, 309
ApeKI GCWGC 7 cut(s) 87, 303, 306, 309, 318, 327, 603
ApoI RAATTY 1 cut(s) 574
AspS9I GGNCC 2 cut(s) 449, 487
AsuHPI GGTGA 2 cut(s) 215, 402
AsuII TTCGAA 1 cut(s) 431
AvaII GGWCC 2 cut(s) 449, 487
BbvI GCAGC 7 cut(s) 74, 293, 296, 305, 314, 315, 590
BccI CCATC 3 cut(s) 417, 477, 516
BfaI CTAG 4 cut(s) 61, 453, 508, 529
BglII AGATCT 1 cut(s) 181
BisI GCNGC 7 cut(s) 88, 304, 307, 310, 319, 328, 604
BlsI GCNGC 7 cut(s) 89, 305, 308, 311, 320, 329, 605
Bme18I GGWCC 2 cut(s) 449, 487
BmgT120I GGNCC 2 cut(s) 449, 487
BmiI GGNNCC 1 cut(s) 488
BplI GAGNNNNNCTC 2 cut(s) 523, 555
Bpu14I TTCGAA 1 cut(s) 431
BsaJI CCNNGG 1 cut(s) 226
Bsc4I CCNNNNNNNGG 2 cut(s) 387, 585
Bse118I RCCGGY 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 503
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 1 cut(s) 179
BseLI CCNNNNNNNGG 2 cut(s) 387, 585
BseNI ACTGG 1 cut(s) 503
BseXI GCAGC 7 cut(s) 74, 293, 296, 305, 314, 315, 590
BseYI CCCAGC 1 cut(s) 129
BsiSI CCGG 1 cut(s) 30
BslFI GGGAC 1 cut(s) 500
BslI CCNNNNNNNGG 2 cut(s) 387, 585
BsmFI GGGAC 1 cut(s) 500
Bsp119I TTCGAA 1 cut(s) 431
Bsp143I GATC 3 cut(s) 181, 272, 377
BspLI GGNNCC 1 cut(s) 488
BspPI GGATC 1 cut(s) 372
BspT104I TTCGAA 1 cut(s) 431
BsrFI RCCGGY 1 cut(s) 29
BsrI ACTGG 1 cut(s) 503
BssAI RCCGGY 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 226
BssMI GATC 3 cut(s) 181, 272, 377
BssT1I CCWWGG 1 cut(s) 226
Bst4CI ACNGT 2 cut(s) 26, 149
Bst6I CTCTTC 1 cut(s) 543
BstAPI GCANNNNNTGC 1 cut(s) 309
BstBI TTCGAA 1 cut(s) 431
BstEII GGTNACC 1 cut(s) 221
BstF5I GGATG 1 cut(s) 179
BstKTI GATC 3 cut(s) 184, 275, 380
BstMBI GATC 3 cut(s) 181, 272, 377
BstMWI GCNNNNNNNGC 6 cut(s) 84, 309, 315, 318, 324, 327
BstPI GGTNACC 1 cut(s) 221
BstV1I GCAGC 7 cut(s) 74, 293, 296, 305, 314, 315, 590
BstX2I RGATCY 1 cut(s) 181
BstXI CCANNNNNNTGG 1 cut(s) 163
BstYI RGATCY 1 cut(s) 181
BtsCI GGATG 1 cut(s) 179
CaiI CAGNNNCTG 3 cut(s) 24, 78, 309
Cfr10I RCCGGY 1 cut(s) 29
Cfr13I GGNCC 2 cut(s) 449, 487
CviAII CATG 2 cut(s) 143, 163
CviJI RGCY 9 cut(s) 65, 87, 129, 195, 279, 306, 461, 467, 534
CviKI_1 RGCY 9 cut(s) 65, 87, 129, 195, 279, 306, 461, 467, 534
DpnI GATC 3 cut(s) 183, 274, 379
DpnII GATC 3 cut(s) 181, 272, 377
DraI TTTAAA 1 cut(s) 341
Eam1104I CTCTTC 1 cut(s) 543
EarI CTCTTC 1 cut(s) 543
Eco130I CCWWGG 1 cut(s) 226
Eco47I GGWCC 2 cut(s) 449, 487
Eco57I CTGAAG 2 cut(s) 265, 483
Eco91I GGTNACC 1 cut(s) 221
EcoO65I GGTNACC 1 cut(s) 221
EcoRI GAATTC 1 cut(s) 574
EcoT14I CCWWGG 1 cut(s) 226
ErhI CCWWGG 1 cut(s) 226
FaeI CATG 2 cut(s) 146, 166
FaiI YATR 7 cut(s) 96, 112, 144, 164, 216, 295, 601
FaqI GGGAC 1 cut(s) 500
FatI CATG 2 cut(s) 142, 162
Fnu4HI GCNGC 7 cut(s) 88, 304, 307, 310, 319, 328, 604
FokI GGATG 1 cut(s) 186
Fsp4HI GCNGC 7 cut(s) 88, 304, 307, 310, 319, 328, 604
FspBI CTAG 4 cut(s) 61, 453, 508, 529
GluI GCNGC 7 cut(s) 88, 304, 307, 310, 319, 328, 604
GsaI CCCAGC 1 cut(s) 133
HapII CCGG 1 cut(s) 30
Hin1II CATG 2 cut(s) 146, 166
HinfI GANTC 2 cut(s) 138, 428
HpaII CCGG 1 cut(s) 30
HphI GGTGA 2 cut(s) 215, 402
Hpy166II GTNNAC 3 cut(s) 44, 152, 287
Hpy188I TCNGA 1 cut(s) 449
Hpy188III TCNNGA 1 cut(s) 542
Hpy8I GTNNAC 3 cut(s) 44, 152, 287
HpyAV CCTTC 2 cut(s) 162, 216
HpyCH4III ACNGT 2 cut(s) 26, 149
HpyCH4V TGCA 1 cut(s) 18
HpyF10VI GCNNNNNNNGC 6 cut(s) 84, 309, 315, 318, 324, 327
Hsp92II CATG 2 cut(s) 146, 166
Kzo9I GATC 3 cut(s) 181, 272, 377
LmnI GCTCC 3 cut(s) 126, 266, 611
Lsp1109I GCAGC 7 cut(s) 74, 293, 296, 305, 314, 315, 590
MaeI CTAG 4 cut(s) 61, 453, 508, 529
MaeIII GTNAC 2 cut(s) 221, 404
MalI GATC 3 cut(s) 183, 274, 379
MboI GATC 3 cut(s) 181, 272, 377
MboII GAAGA 2 cut(s) 201, 560
MflI RGATCY 1 cut(s) 181
MluCI AATT 6 cut(s) 37, 200, 349, 503, 574, 580
MmeI TCCRAC 2 cut(s) 115, 427
MseI TTAA 2 cut(s) 340, 475
MslI CAYNNNNRTG 1 cut(s) 250
MspA1I CMGCKG 1 cut(s) 306
MspI CCGG 1 cut(s) 30
MwoI GCNNNNNNNGC 6 cut(s) 84, 309, 315, 318, 324, 327
NdeII GATC 3 cut(s) 181, 272, 377
NlaIII CATG 2 cut(s) 146, 166
NlaIV GGNNCC 1 cut(s) 488
NmuCI GTSAC 1 cut(s) 221
NspV TTCGAA 1 cut(s) 431
PfeI GAWTC 2 cut(s) 138, 428
PflMI CCANNNNNTGG 2 cut(s) 387, 585
PkrI GCNGC 7 cut(s) 89, 305, 308, 311, 320, 329, 605
PspEI GGTNACC 1 cut(s) 221
PspFI CCCAGC 1 cut(s) 129
PspN4I GGNNCC 1 cut(s) 488
PspPI GGNCC 2 cut(s) 449, 487
PstNI CAGNNNCTG 3 cut(s) 24, 78, 309
PsuI RGATCY 1 cut(s) 181
PvuII CAGCTG 1 cut(s) 306
RseI CAYNNNNRTG 1 cut(s) 250
SaqAI TTAA 2 cut(s) 340, 475
SatI GCNGC 7 cut(s) 88, 304, 307, 310, 319, 328, 604
Sau3AI GATC 3 cut(s) 181, 272, 377
Sau96I GGNCC 2 cut(s) 449, 487
SetI ASST 9 cut(s) 89, 131, 228, 308, 404, 454, 463, 536, 600
SfuI TTCGAA 1 cut(s) 431
SinI GGWCC 2 cut(s) 449, 487
SmiMI CAYNNNNRTG 1 cut(s) 250
Sse9I AATT 6 cut(s) 37, 200, 349, 503, 574, 580
SspMI CTAG 4 cut(s) 61, 453, 508, 529
StyI CCWWGG 1 cut(s) 226
TaaI ACNGT 2 cut(s) 26, 149
TaqI TCGA 1 cut(s) 431
TasI AATT 6 cut(s) 37, 200, 349, 503, 574, 580
TfiI GAWTC 2 cut(s) 138, 428
Tru1I TTAA 2 cut(s) 340, 475
Tru9I TTAA 2 cut(s) 340, 475
TseFI GTSAC 1 cut(s) 221
TseI GCWGC 7 cut(s) 87, 303, 306, 309, 318, 327, 603
Tsp45I GTSAC 1 cut(s) 221
TspDTI ATGAA 3 cut(s) 46, 361, 561
TspGWI ACGGA 2 cut(s) 404, 598
Van91I CCANNNNNTGG 2 cut(s) 387, 585
VpaK11BI GGWCC 2 cut(s) 449, 487
XapI RAATTY 1 cut(s) 574
XspI CTAG 4 cut(s) 61, 453, 508, 529
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.