Rmu_sc0011424.1_g000032

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011424.1
Physical Location & Seq
Forward (+)
100655 .. 111574
10920 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011424.1_g000032.1.cds

Sequence Viewer

Length: 5700 bp
atgaccaccactcaaacctcctcaactttgccccatttcacccgtccacggaaatttgaggttttcctgagttttagaggtttagacacccgaaaaggttttactgaccacctatacaaggctttatttcttaatggaatccacacttttagggatgatgaacaacttgagagtgggaaacccatttcgttggaactctccaaagcaattcgagaatcagaaatttcagtcatcattctttcaaaaaactatgcaacctcaacatggtgtctagatgaactagcggaaatggttgaacgcatggatgagcctggaggactcataatcttgcctgtgttctatgacgtgacaccatctcaagtacgagagcagaccggagattcttttgaagaagcgttcgctcaacatgaacacaatttcgtaggggacacaggaaaggtgacaagatggagaaaatctttgattcaagtcgctggcctctccggatatgatttaagaaattttaggcacgaaacagaagtgattcaaaggatagttgaacgcatttttggtgcattgaattacacaaaccatatattctctaatgatttgaaggactttgttggtattgatcgtgtgaaagaaattgaattgaacttgtgtatggagtcggaagaaatttgtgtagttgggatttgtggcatgccagggattggtaagacaacagttgcacaagctctttttgtaagaatccgcaatcaatttgaagcttttagtttcatttctaaggttggagaaatatctaggagtgaaagtttatttcatatccaagaacaactttgtgatgacttgttgaatagaaaagtaaacataaagaatgtcaatgaagtcataagcaggagattgcgtggcaaacgagtgcttatcgttcttgacaatgtggatgaattagaacaaatagagtctgtagctggcagtggtgataatttgtatgatcgattcggtcctggtagtagaatcatcataactacaagagatgaaaggttgttgataaactatgagccaaaaatatacaaggttgagaaacttactgaagatgaagctcttctgctcttctgtcggaaagcatttaagaaagaccatcctttggatggatttgctgagctggcttacaaatttgtagactatattgacggtcttcctttggctcttgtagttttgggttcctcattattcaaaagaagtgtaaaagaatggtctagtaagtttaatagattgaaagattacaattattctggtgagaggaaaatcattgatattctcaaagtcagttttgatggattagagaatcaagcagagaaggaaatatttttagacactgcatgtttcttcaaaggcgaggatgcatgtcgtgtagaaaagatatttgagagttgtggctactatccggacatcagtatcaatatcctccttgagaaatatttagtaagtattataggaggaaaactgtggatgcatgatttacttcaagaaatgggcagagaaattgttcgaggagagtcccaaaagccaggaaagcgcagcagattgtggcttcatacagatgcccttcctttacttaggaataataaggggacagatgctgtcaaaggtatcttcttatgctcgcctcaacaagacaatgtgcacttgaaggcagatcccttcgcaaacatggaaagtctaagaatgttgaaaatttacaatgtgatattttctggatgccttgagtttctttcaaatgagttaagcttcttggaatggcatggatatcctttaaaatctctgccttcatgttttgaacctgataaacttgttgaactgaatttgtatcagagtgaaatagagcaattgtgggaagaaattgagaggcctttggaaaagttggtgataatcaaccttaccgactgtgaatacttgatcaagacccctgactttgataaagtgccaaagcttgagaggctaatcctcaaaggttgtaccagattgtctgaggttgacctctctgttggagtgctgcaacggctcattttgctgaatctggaaggttgtgaatgtcttactactcttcttcccaacagtatcaacttgagatcgctcacaaagttcattctttcgggatgttccaaactgaaaaaccttccagaatttggggaagaaatgaaacaattaagggaacttcacttaaatgggacagctatagaagagctaccaacatcaatgaaacatttgactggccttactctgctcaatctcaaagaatgcaagaaccttctttgtctgccagaggtcatttgtaccgctttgacatcacttcaaatattgaacctctcagggtgtttaaatcttgccttgttgccggaaagcttggtgtgtttagaatacttagaggagcttcatgcaggtgggagtgctataccacaatttccgtcctccattctacatctgaaaaacctgcaagttttatgttttgctggttgtaagggactgccatcctctgcgggtttcgagttgcctgcttcattttcatctggtttatggtctttgaagaaattaaaccttcgcaactgcaatctgtgtgaaggatcaatcccagatgatcttggaagcgtatcctctttgcagtatctagatttaagtggaaacaatttcatgaccataccaaaaagtatctctcaactttctcagcttgaagaccttgtattggataattgtagcaaccttcaatcattgccaagacttccatccagtataagagttgtaacggcacagaattgtcctctcctacagggaacacattcgaataaattaacggtgtggacttccactgctgcaggatttagtgttataaattgccaaagtggtgaagccaagcctcagtggattgacttacctgatccacatcttcggaggccattctgtcaaacattcttcgagggtgcaatttatcgtggtagtaattttgaatatagttatatatcaaaggatactcctgcatggttgagccgtcggagtactggatcatctataacaatcccactacctccggatttggatgataactgtaaatggatgggatttgctctgtgttttacttgtgtaacgcagcatcatgattctctggatacaacatatgtcttccttgatgaccaaaagcaaataaacttgaatcgcaattaccgtattcatttctatacaacggaagatcctcttgaacgtcccctagtgcataattaccctgattgcgattgggttggatcattcatgcactggaactatacaccaagaagtgattttgtagaaatttcgaataaacgcttcatccgagctacaattgtaccaggcagcccagaggtggaggtgacagggtgtgccgccagtctaatatacttggaagaagtggcagaatttgtccagaaaatgaatattcaccatgacaattgcaataaaggttataggtatctagtggatgcaatgggaagtattccttcgacgagcaggattcaaactaaaccagaagtacaaaaacaagaaactactactacttctgccaggcttgtaggacaattgagaagaaacgtggtgtcgttggttggagaactatttgaggggggcaacccacgtcgctatgattatggttttattttgcctctgggagaaaaattagcttggtttagtgaacaaagtactggttgtgtagtgagctcccctcttcctccagagctgcataatgatgagaattgggtaggatttgctctctatgttgtttgcactttgcctccaggtgttagccttagccacagattatcattctttgagtgtcaatttcatacatctaatgaagccgtgggtccgaaccaattgatacatcgcctagtgttacgttcccccttcgatgacaatttgatggggtcaaatcgactccttcttattcatgtaccacgagcacgttttccagaacgattgaaccggtgtcgttgcattcaagctttatttggatccaccactctaggtgtgcaggttgatatatgtgggatgcatctagtatacgaccaagacttgaacggcttagtccaaacaattgcccactgcgctgtgactagtcagcctgtttactacggaattggtgatttgacagttgccacgaaattaggtaacaatgctggaatgacagctatgattacgaatttgctcgaggcagccaaatccagtgagggcaggtcattacgccaagttcgtcttcctgtggctttggggcctgtagattccggtgagactactctgacttttagaggttctatcttctttcctgctgacggctcgcaacatgaaacagaaagaaggcccgttcatggggacgaaacaagtgcaattggtgatttcaagtttctgctaccggactttggcccttccttcgaccgtttcaataacatgcgcttggataatcagatcctgggttttgatcgttacttgaaatacaattcttgtttccctcctaatgaaattgcagagtggtttgggcatccaagcagtgggtcctccgtaacaatccctctaccatcatatctgtacgatgaccccaattggacaggactagctttatgtgcatacttttcagtcctcaactatacaactaccgaccttgacaatttggatcaagaaatttctcacaaccttacatgtcttcttgaaactgatagaggttgtctggagtctcttcatggctattgcaccaccaaccaagaatttgagtggttatatcatatgggaggattcatttggttgtcttatataccacgatggtggtttttagatcagttgaatgaatgcagccacctggaggcttcaattgcaagtgaccgtggaagcttgtgtgtgcataggtgtggtctccgtcttttatatctgcaagatgaggaagggtttaagcagaccataatgcactacatgacctccttgtctgatattgatcaagggaaaaataagcaattccaggactgcaaggtgggatcatctcctagaactggcagctacattgactttgatcgttactcggtacataatttttgtttccctgcaactgtagctctagagtggtttgggcatcaaagcagcggctcctcagtaacagtctcactaccaccgaacttgcatagtgacgctaattggataggattgactttatgtgcatccttctcagtcgtggagcatccaactgccgaccttgaaaatttagattcaggaaattctcaccacctgatatgtcatttggagtcagaaagaggtagtatcgaacctcttcataactattgcaccaccaacgaagaattccagtggttgcattttggaggattcatttgggtatcctatataccacgagagtggtttttggatcagttgaatgaatgcagtgtcctcgagacttcaattgcaagtgatcatgaaagctttagggtgcataaatgtgaggtccgttgtgtatatcagcatgatatggaagagtttaagcagaacatattgcactgtatgacctcgttctcttgcaataaaggagatgacaagcaatgccttgcacgtgaatgccctgcaggtgatgcaggatcatcaagcactcctagcagcttcattgtggaacctcatcttgaaagattagaatggctgaattacaagaaatgggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1899

Amino Acids

215.1

Weight (kDa)

5.44

Isoelectric Point (pI)

44.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2867
AarI CACCTGC 2 cut(s) 2411, 5597
AasI GACNNNNNNGTC 1 cut(s) 4975
Acc36I ACCTGC 5 cut(s) 2411, 2481, 4027, 4227, 5597
AccB7I CCANNNNNTGG 4 cut(s) 692, 1126, 2168, 4550
AccI GTMKAC 2 cut(s) 1161, 4065
AccIII TCCGGA 3 cut(s) 482, 1426, 3064
AciI CCGC 6 cut(s) 284, 733, 2319, 2519, 3393, 5133
AcuI CTGAAG 1 cut(s) 1092
AcvI CACGTG 1 cut(s) 5594
AflIII ACRYGT 1 cut(s) 4697
AgeI ACCGGT 1 cut(s) 3987
AhlI ACTAGT 1 cut(s) 4118
AjiI CACGTC 2 cut(s) 346, 3641
AjuI GAANNNNNNNTTGG 6 cut(s) 531, 563, 4242, 4274, 5330, 5362
AleI CACNNNNGTG 2 cut(s) 4819, 5398
Alw21I GWGCWC 3 cut(s) 1668, 3725, 3967
Alw26I GTCTC 5 cut(s) 4286, 4737, 4913, 5155, 5432
Alw44I GTGCAC 1 cut(s) 1664
AlwNI CAGNNNCTG 2 cut(s) 1622, 4471
Ama87I CYCGRG 2 cut(s) 4211, 5435
Aor13HI TCCGGA 3 cut(s) 482, 1426, 3064
AoxI GGCC 7 cut(s) 475, 1889, 2254, 2930, 4274, 4361, 4423
ApaLI GTGCAC 1 cut(s) 1664
AsiGI ACCGGT 1 cut(s) 3987
Asp700I GAANNNNTTC 5 cut(s) 522, 1083, 1527, 2815, 5316
AspLEI GCGC 3 cut(s) 1560, 4112, 4455
AspS9I GGNCC 7 cut(s) 983, 3869, 4274, 4362, 4424, 4554, 5488
AsuII TTCGAA 2 cut(s) 2819, 3326
AvaI CYCGRG 2 cut(s) 4211, 5435
AvaII GGWCC 4 cut(s) 983, 3869, 4554, 5488
BaeGI GKGCMC 1 cut(s) 1668
BaeI ACNNNNGTAYC 4 cut(s) 1420, 1453, 3339, 3372
BamHI GGATCC 1 cut(s) 4016
BanII GRGCYC 1 cut(s) 3725
BauI CACGAG 2 cut(s) 3960, 5394
BbrPI CACGTG 1 cut(s) 5594
BbsI GAAGAC 5 cut(s) 1169, 2718, 3148, 4250, 4694
Bbv12I GWGCWC 3 cut(s) 1668, 3725, 3967
BceAI ACGGC 6 cut(s) 2057, 2799, 3009, 3848, 4099, 4351
BcgI CGANNNNNNTGC 6 cut(s) 2516, 2550, 4367, 4401, 5416, 5450
BciVI GTATCC 4 cut(s) 2641, 2998, 3136, 5392
BclI TGATCA 3 cut(s) 1938, 4987, 5455
BcoDI GTCTC 5 cut(s) 4286, 4737, 4913, 5155, 5432
BcuI ACTAGT 1 cut(s) 4118
BfmI CTRYAG 7 cut(s) 945, 2217, 2804, 2850, 4278, 5100, 5604
BfuAI ACCTGC 5 cut(s) 2411, 2481, 4027, 4227, 5597
BfuI GTATCC 4 cut(s) 2641, 2998, 3136, 5392
BlpI GCTNAGC 1 cut(s) 1140
BmcAI AGTACT 2 cut(s) 3034, 3706
Bme18I GGWCC 4 cut(s) 983, 3869, 4554, 5488
BmeT110I CYCGRG 2 cut(s) 4211, 5435
BmgBI CACGTC 2 cut(s) 346, 3641
BmgT120I GGNCC 7 cut(s) 983, 3869, 4274, 4362, 4424, 4554, 5488
BmiI GGNNCC 7 cut(s) 1204, 3870, 4018, 4275, 4555, 5137, 5652
BpiI GAAGAC 5 cut(s) 1169, 2718, 3148, 4250, 4694
BplI GAGNNNNNCTC 2 cut(s) 3712, 3744
BpmI CTGGAG 5 cut(s) 333, 3720, 3783, 4748, 4877
Bpu10I CCTNAGC 1 cut(s) 3812
Bpu1102I GCTNAGC 1 cut(s) 1140
Bpu14I TTCGAA 2 cut(s) 2819, 3326
BpuEI CTTGAG 6 cut(s) 188, 342, 1472, 1766, 1994, 2128
Bsa29I ATCGAT 1 cut(s) 976
BsaAI YACGTR 1 cut(s) 5594
BsaBI GATNNNNATC 2 cut(s) 2919, 4986
BsaI GGTCTC 1 cut(s) 4913
BsaJI CCNNGG 5 cut(s) 47, 686, 3864, 4471, 4879
BsaWI WCCGGW 7 cut(s) 374, 482, 1426, 3064, 3987, 4286, 4414
BsaXI ACNNNNNCTCC 8 cut(s) 778, 808, 871, 901, 3781, 3811, 4955, 4985
Bse118I RCCGGY 1 cut(s) 3987
Bse1I ACTGG 9 cut(s) 2257, 2766, 3040, 3293, 3396, 3712, 4227, 5047, 5350
Bse3DI GCAATG 3 cut(s) 2747, 3498, 5588
Bse8I GATNNNNATC 2 cut(s) 2919, 4986
BseAI TCCGGA 3 cut(s) 482, 1426, 3064
BseCI ATCGAT 1 cut(s) 976
BseDI CCNNGG 5 cut(s) 47, 686, 3864, 4471, 4879
BseJI GATNNNNATC 2 cut(s) 2919, 4986
BseMI GCAATG 3 cut(s) 2747, 3498, 5588
BseMII CTCAG 8 cut(s) 59, 1131, 2001, 2364, 2717, 2909, 5154, 5229
BseNI ACTGG 9 cut(s) 2257, 2766, 3040, 3293, 3396, 3712, 4227, 5047, 5350
BseRI GAGGAG 4 cut(s) 10, 1548, 2423, 5128
BseSI GKGCMC 1 cut(s) 1668
BsgI GTGCAG 1 cut(s) 4055
Bsh1285I CGRYCG 1 cut(s) 4438
BshFI GGCC 7 cut(s) 477, 1891, 2256, 2932, 4276, 4363, 4425
BshTI ACCGGT 1 cut(s) 3987
BshVI ATCGAT 1 cut(s) 976
BsiEI CGRYCG 1 cut(s) 4438
BsiHKAI GWGCWC 3 cut(s) 1668, 3725, 3967
BsiHKCI CYCGRG 2 cut(s) 4211, 5435
BsiSI CCGG 8 cut(s) 375, 483, 1427, 2378, 3065, 3988, 4287, 4415
BslFI GGGAC 7 cut(s) 440, 1525, 1627, 2224, 2517, 3222, 4388
BsmAI GTCTC 5 cut(s) 4286, 4737, 4913, 5155, 5432
BsmFI GGGAC 7 cut(s) 440, 1525, 1627, 2224, 2517, 3222, 4388
BsmI GAATGC 5 cut(s) 2285, 3999, 4850, 5429, 5603
BsnI GGCC 7 cut(s) 477, 1891, 2256, 2932, 4276, 4363, 4425
Bso31I GGTCTC 1 cut(s) 4913
BsoBI CYCGRG 2 cut(s) 4211, 5435
Bsp119I TTCGAA 2 cut(s) 2819, 3326
Bsp1286I GDGCHC 3 cut(s) 1668, 3725, 3967
Bsp13I TCCGGA 3 cut(s) 482, 1426, 3064
Bsp1720I GCTNAGC 1 cut(s) 1140
BspACI CCGC 6 cut(s) 284, 733, 2319, 2519, 3393, 5133
BspANI GGCC 7 cut(s) 477, 1891, 2256, 2932, 4276, 4363, 4425
BspCNI CTCAG 8 cut(s) 60, 1132, 2002, 2363, 2716, 2908, 5153, 5228
BspDI ATCGAT 1 cut(s) 976
BspEI TCCGGA 3 cut(s) 482, 1426, 3064
BspHI TCATGA 3 cut(s) 2670, 3130, 5458
BspLI GGNNCC 7 cut(s) 1204, 3870, 4018, 4275, 4555, 5137, 5652
BspMAI CTGCAG 2 cut(s) 2854, 5608
BspMI ACCTGC 5 cut(s) 2411, 2481, 4027, 4227, 5597
BspQI GCTCTTC 3 cut(s) 1089, 1097, 2217
BspT104I TTCGAA 2 cut(s) 2819, 3326
BspTNI GGTCTC 1 cut(s) 4913
BsrDI GCAATG 3 cut(s) 2747, 3498, 5588
BsrFI RCCGGY 1 cut(s) 3987
BsrI ACTGG 9 cut(s) 2257, 2766, 3040, 3293, 3396, 3712, 4227, 5047, 5350
BssAI RCCGGY 1 cut(s) 3987
BssECI CCNNGG 5 cut(s) 47, 686, 3864, 4471, 4879
BssNAI GTATAC 1 cut(s) 4066
BssSI CACGAG 2 cut(s) 3960, 5394
Bst1107I GTATAC 1 cut(s) 4066
Bst2BI CACGAG 2 cut(s) 3960, 5394
Bst6I CTCTTC 8 cut(s) 1089, 1097, 2091, 2217, 3735, 4740, 5322, 5511
BstAPI GCANNNNNTGC 1 cut(s) 5612
BstBAI YACGTR 1 cut(s) 5594
BstBI TTCGAA 2 cut(s) 2819, 3326
BstC8I GCNNGC 7 cut(s) 475, 683, 952, 1146, 1646, 2535, 4340
BstDSI CCRYGG 3 cut(s) 47, 3864, 4879
BstENI CCTNNNNNAGG 1 cut(s) 116
BstHHI GCGC 3 cut(s) 1560, 4112, 4455
BstMAI GTCTC 5 cut(s) 4286, 4737, 4913, 5155, 5432
BstMCI CGRYCG 1 cut(s) 4438
BstNSI RCATGY 5 cut(s) 685, 1365, 1389, 4453, 4701
BstSFI CTRYAG 7 cut(s) 945, 2217, 2804, 2850, 4278, 5100, 5604
BstSLI GKGCMC 1 cut(s) 1668
BstV2I GAAGAC 5 cut(s) 1169, 2718, 3148, 4250, 4694
BstX2I RGATCY 4 cut(s) 1678, 3223, 4016, 4467
BstXI CCANNNNNNTGG 3 cut(s) 190, 4821, 5400
BstYI RGATCY 4 cut(s) 1678, 3223, 4016, 4467
BstZ17I GTATAC 1 cut(s) 4066
Bsu15I ATCGAT 1 cut(s) 976
BsuI GTATCC 4 cut(s) 2641, 2998, 3136, 5392
BsuRI GGCC 7 cut(s) 477, 1891, 2256, 2932, 4276, 4363, 4425
BsuTUI ATCGAT 1 cut(s) 976
BtgI CCRYGG 3 cut(s) 47, 3864, 4879
BtgZI GCGATG 1 cut(s) 3872
BtrI CACGTC 2 cut(s) 346, 3641
BtsI GCAGTG 6 cut(s) 961, 1356, 2844, 4105, 4555, 5434
BveI ACCTGC 5 cut(s) 2411, 2481, 4027, 4227, 5597
Cac8I GCNNGC 7 cut(s) 475, 683, 952, 1146, 1646, 2535, 4340
CaiI CAGNNNCTG 2 cut(s) 1622, 4471
CciI TCATGA 3 cut(s) 2670, 3130, 5458
CfoI GCGC 3 cut(s) 1560, 4112, 4455
Cfr10I RCCGGY 1 cut(s) 3987
Cfr13I GGNCC 7 cut(s) 983, 3869, 4274, 4362, 4424, 4554, 5488
ClaI ATCGAT 1 cut(s) 976
CseI GACGC 1 cut(s) 5186
CspAI ACCGGT 1 cut(s) 3987
CspCI CAANNNNNGTGG 2 cut(s) 5148, 5183
DraI TTTAAA 2 cut(s) 1797, 2361
DrdI GACNNNNNNGTC 1 cut(s) 4975
DseDI GACNNNNNNGTC 1 cut(s) 4975
Eam1104I CTCTTC 8 cut(s) 1089, 1097, 2091, 2217, 3735, 4740, 5322, 5511
EarI CTCTTC 8 cut(s) 1089, 1097, 2091, 2217, 3735, 4740, 5322, 5511
Ecl136II GAGCTC 1 cut(s) 3723
Eco147I AGGCCT 1 cut(s) 1891
Eco24I GRGCYC 1 cut(s) 3725
Eco31I GGTCTC 1 cut(s) 4913
Eco32I GATATC 1 cut(s) 1790
Eco47I GGWCC 4 cut(s) 983, 3869, 4554, 5488
Eco53kI GAGCTC 1 cut(s) 3723
Eco57I CTGAAG 1 cut(s) 1092
Eco72I CACGTG 1 cut(s) 5594
Eco88I CYCGRG 2 cut(s) 4211, 5435
EcoICRI GAGCTC 1 cut(s) 3723
EcoNI CCTNNNNNAGG 1 cut(s) 116
EcoO109I RGGNCCY 2 cut(s) 4274, 4554
EcoRI GAATTC 1 cut(s) 5345
EcoRV GATATC 1 cut(s) 1790
EcoT22I ATGCAT 3 cut(s) 1387, 1497, 4059
EcoT38I GRGCYC 1 cut(s) 3725
FalI AAGNNNNNCTT 8 cut(s) 801, 833, 3213, 3245, 3490, 3522, 4242, 4274
FaqI GGGAC 7 cut(s) 440, 1525, 1627, 2224, 2517, 3222, 4388
FauI CCCGC 1 cut(s) 2512
FauNDI CATATG 2 cut(s) 3151, 4782
FbaI TGATCA 3 cut(s) 1938, 4987, 5455
FblI GTMKAC 2 cut(s) 1161, 4065
FriOI GRGCYC 1 cut(s) 3725
GlaI GCGC 3 cut(s) 1559, 4111, 4454
GsuI CTGGAG 5 cut(s) 333, 3720, 3783, 4748, 4877
HaeIII GGCC 7 cut(s) 477, 1891, 2256, 2932, 4276, 4363, 4425
HapII CCGG 8 cut(s) 375, 483, 1427, 2378, 3065, 3988, 4287, 4415
HgaI GACGC 1 cut(s) 5186
HhaI GCGC 3 cut(s) 1560, 4112, 4455
Hin6I GCGC 3 cut(s) 1558, 4110, 4453
HinP1I GCGC 3 cut(s) 1558, 4110, 4453
HincII GTYRAC 1 cut(s) 2017
HindII GTYRAC 1 cut(s) 2017
HindIII AAGCTT 7 cut(s) 747, 1768, 1970, 2383, 4005, 4885, 5464
HpaII CCGG 8 cut(s) 375, 483, 1427, 2378, 3065, 3988, 4287, 4415
Hpy166II GTNNAC 9 cut(s) 47, 847, 1162, 1666, 2017, 2838, 3698, 4066, 4132
Hpy8I GTNNAC 9 cut(s) 47, 847, 1162, 1666, 2017, 2838, 3698, 4066, 4132
Hpy99I CGWCG 3 cut(s) 3030, 3514, 3645
HpyCH4IV ACGT 7 cut(s) 345, 3235, 3597, 3640, 3901, 3967, 5593
HpySE526I ACGT 7 cut(s) 345, 3235, 3597, 3640, 3901, 3967, 5593
HspAI GCGC 3 cut(s) 1558, 4110, 4453
Kpn2I TCCGGA 3 cut(s) 482, 1426, 3064
Ksp22I TGATCA 3 cut(s) 1938, 4987, 5455
LguI GCTCTTC 3 cut(s) 1089, 1097, 2217
LmnI GCTCC 4 cut(s) 2410, 3728, 5141, 5224
MaeII ACGT 7 cut(s) 345, 3235, 3597, 3640, 3901, 3967, 5593
MflI RGATCY 4 cut(s) 1678, 3223, 4016, 4467
MhlI GDGCHC 3 cut(s) 1668, 3725, 3967
MlyI GAGTC 7 cut(s) 312, 656, 950, 1547, 3933, 4739, 5300
MmeI TCCRAC 9 cut(s) 171, 630, 751, 1079, 2008, 3008, 3253, 3592, 5255
Mph1103I ATGCAT 3 cut(s) 1387, 1497, 4059
MroI TCCGGA 3 cut(s) 482, 1426, 3064
MroXI GAANNNNTTC 5 cut(s) 522, 1083, 1527, 2815, 5316
MslI CAYNNNNRTG 9 cut(s) 1581, 2205, 2421, 3750, 4819, 4902, 5398, 5481, 5596
MspA1I CMGCKG 1 cut(s) 5133
MspI CCGG 8 cut(s) 375, 483, 1427, 2378, 3065, 3988, 4287, 4415
Mva1269I GAATGC 5 cut(s) 2285, 3999, 4850, 5429, 5603
NdeI CATATG 2 cut(s) 3151, 4782
NlaIV GGNNCC 7 cut(s) 1204, 3870, 4018, 4275, 4555, 5137, 5652
NmuCI GTSAC 6 cut(s) 346, 439, 3379, 4114, 4874, 5174
NsiI ATGCAT 3 cut(s) 1387, 1497, 4059
NspI RCATGY 5 cut(s) 685, 1365, 1389, 4453, 4701
NspV TTCGAA 2 cut(s) 2819, 3326
OliI CACNNNNGTG 2 cut(s) 4819, 5398
PaeI GCATGC 1 cut(s) 685
PaeR7I CTCGAG 2 cut(s) 4211, 5435
PagI TCATGA 3 cut(s) 2670, 3130, 5458
PaqCI CACCTGC 2 cut(s) 2411, 5597
PceI AGGCCT 1 cut(s) 1891
PciI ACATGT 1 cut(s) 4697
PciSI GCTCTTC 3 cut(s) 1089, 1097, 2217
PcsI WCGNNNNNNNCGW 3 cut(s) 3196, 3340, 4252
PctI GAATGC 5 cut(s) 2285, 3999, 4850, 5429, 5603
PdmI GAANNNNTTC 5 cut(s) 522, 1083, 1527, 2815, 5316
PflMI CCANNNNNTGG 4 cut(s) 692, 1126, 2168, 4550
PfoI TCCNGGA 1 cut(s) 5010
PinAI ACCGGT 1 cut(s) 3987
PleI GAGTC 7 cut(s) 312, 655, 949, 1546, 3933, 4738, 5299
PmaCI CACGTG 1 cut(s) 5594
PmlI CACGTG 1 cut(s) 5594
PpsI GAGTC 7 cut(s) 312, 655, 949, 1546, 3933, 4738, 5299
Ppu21I YACGTR 1 cut(s) 5594
PpuMI RGGWCCY 1 cut(s) 4554
PscI ACATGT 1 cut(s) 4697
PsiI TTATAA 1 cut(s) 2867
Psp124BI GAGCTC 1 cut(s) 3725
Psp5II RGGWCCY 1 cut(s) 4554
PspCI CACGTG 1 cut(s) 5594
PspN4I GGNNCC 7 cut(s) 1204, 3870, 4018, 4275, 4555, 5137, 5652
PspPI GGNCC 7 cut(s) 983, 3869, 4274, 4362, 4424, 4554, 5488
PspPPI RGGWCCY 1 cut(s) 4554
PspXI VCTCGAGB 1 cut(s) 4211
PstI CTGCAG 2 cut(s) 2854, 5608
PstNI CAGNNNCTG 2 cut(s) 1622, 4471
PsuI RGATCY 4 cut(s) 1678, 3223, 4016, 4467
RseI CAYNNNNRTG 9 cut(s) 1581, 2205, 2421, 3750, 4819, 4902, 5398, 5481, 5596
SacI GAGCTC 1 cut(s) 3725
SapI GCTCTTC 3 cut(s) 1089, 1097, 2217
Sau96I GGNCC 7 cut(s) 983, 3869, 4274, 4362, 4424, 4554, 5488
SbfI CCTGCAGG 1 cut(s) 5608
ScaI AGTACT 2 cut(s) 3034, 3706
SchI GAGTC 7 cut(s) 312, 656, 950, 1547, 3933, 4739, 5300
SdaI CCTGCAGG 1 cut(s) 5608
SduI GDGCHC 3 cut(s) 1668, 3725, 3967
SfcI CTRYAG 7 cut(s) 945, 2217, 2804, 2850, 4278, 5100, 5604
Sfr274I CTCGAG 2 cut(s) 4211, 5435
SfuI TTCGAA 2 cut(s) 2819, 3326
SinI GGWCC 4 cut(s) 983, 3869, 4554, 5488
SlaI CTCGAG 2 cut(s) 4211, 5435
SmiMI CAYNNNNRTG 9 cut(s) 1581, 2205, 2421, 3750, 4819, 4902, 5398, 5481, 5596
SmlI CTYRAG 8 cut(s) 167, 357, 1451, 1745, 1973, 2107, 4211, 5435
SmoI CTYRAG 8 cut(s) 167, 357, 1451, 1745, 1973, 2107, 4211, 5435
SpeI ACTAGT 1 cut(s) 4118
SphI GCATGC 1 cut(s) 685
Sse8387I CCTGCAGG 1 cut(s) 5608
SseBI AGGCCT 1 cut(s) 1891
SsiI CCGC 6 cut(s) 284, 733, 2319, 2519, 3393, 5133
SspI AATATT 4 cut(s) 1347, 1460, 2340, 3445
SstI GAGCTC 1 cut(s) 3725
StuI AGGCCT 1 cut(s) 1891
TaiI ACGT 7 cut(s) 348, 3238, 3600, 3643, 3904, 3970, 5596
TaqII GACCGA 1 cut(s) 971
TatI WGTACW 3 cut(s) 3032, 3538, 3704
TauI GCSGC 2 cut(s) 3395, 5136
TseFI GTSAC 6 cut(s) 346, 439, 3379, 4114, 4874, 5174
Tsp45I GTSAC 6 cut(s) 346, 439, 3379, 4114, 4874, 5174
TspGWI ACGGA 7 cut(s) 64, 2436, 3233, 4152, 4549, 4901, 5480
Van91I CCANNNNNTGG 4 cut(s) 692, 1126, 2168, 4550
VneI GTGCAC 1 cut(s) 1664
VpaK11BI GGWCC 4 cut(s) 983, 3869, 4554, 5488
XagI CCTNNNNNAGG 1 cut(s) 116
XbaI TCTAGA 3 cut(s) 271, 2647, 5107
XceI RCATGY 5 cut(s) 685, 1365, 1389, 4453, 4701
XcmI CCANNNNNNNNNTGG 1 cut(s) 1127
XhoI CTCGAG 2 cut(s) 4211, 5435
XmiI GTMKAC 2 cut(s) 1161, 4065
XmnI GAANNNNTTC 5 cut(s) 522, 1083, 1527, 2815, 5316
ZrmI AGTACT 2 cut(s) 3034, 3706
Zsp2I ATGCAT 3 cut(s) 1387, 1497, 4059
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.