Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011424.1

Orthogroup ID

OG0001545

Physical Location & Seq

Genomic Coordinates Forward (+)

111635 .. 112755

Gene Structure 1121 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011424.1_g000033.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 894 bp

atggagcatccgactgacaaccttgacacttcggacattcaagtaatttcccaccacctgatatgtcatttggaatcagagagaggcagtctagaatctctccatgactactgcaccaccaatgaagaattcatgtggttgcatcttggaggattcatttggctatcctatataccacgagcgtggttttcagatcagttgaatgaatgcggtgttctggcggcttcaattgcaagtgatcacaaagtatttagtgtgcacatgtgtgggcttcatcttatacatcagcgtgatgaggaagagtttaaacagaccctagtgcattatatggcgttgtcgtcagataataaagggaaaaataagcaataccatcacggtgagatgggatcatcgagcaaaacagacagcaggattgaggaactccctcaccttgaaagagtgcttgatgatatcaaggtgccccaactcttgtgcaccggccaagttgatacccagactctcagtgttaccaatgctaggaggagatttgggaaggaacaagagctcctaagattggatttcgaggaagacattttctggattttgggaaatcctaacacgccgcccaatcgccgcggcgatccacctccgtcgacctgcctcacccgacatgcaccgccgatgtccggctttaggtcaatcccgcctcaacctaatggccttctgcaaagacttcaatgcccaacacagaagcacaaacccgatactcccatggcagtgaccattacggtgttcaaggacaacactttcaaattcaccgtcaagtcaccgccgatgacgtggtatttgaagaaggcggcggggattgagtccgagagaggctggctagggcacgcggtggcgtcgacgctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

297

Amino Acids

33.82

Weight (kDa)

6.17

Isoelectric Point (pI)

52.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001545)

Species	Orthologous Gene IDs
malus_domestica	MD12G1068700.v1.1
prunus_persica	Prupe.7G065300_v2.0.a1 Prupe.7G065400_v2.0.a1 Prupe.7G065500_v2.0.a1 Prupe.7G065600_v2.0.a1
pyrus_communis	pycom12g06030 pycom13g10720
rosa_chinensis	RchiOBHm_Chr1g0317981 RchiOBHm_Chr1g0317991 RchiOBHm_Chr4g0429701 RchiOBHm_Chr4g0429711
rosa_laevigata	RLG00000007048 RLG00000007049 RLG00000007051 RLG00000030565 RLG00000030570
rosa_multiflora	Rmu_co8025080.1_g000001 Rmu_co8402911.1_g000001 Rmu_sc0010349.1_g000002 Rmu_sc0011424.1_g000032 Rmu_sc0011424.1_g000033 Rmu_ssc0000008.1_g000024 Rmu_ssc0000008.1_g000026 Rmu_ssc0000008.1_g000027
rosa_roxburghii	Rroxscaffold_2G00084300 Rroxscaffold_3G00269640 Rroxscaffold_4G00330050 Rroxscaffold_4G00330060 Rroxscaffold_4G00330070 Rroxscaffold_5G00371450 Rroxscaffold_5G00371480 Rroxscaffold_5G00371490 Rroxscaffold_5G00371500 Rroxscaffold_7G00216530
rosa_rugosa	Rorug01G0019000 Rorug01G0019000 Rorug04G0237600
rosa_samantha	Rh1AG030600 Rh1CG029300 Rh1DG018600 Rh1DG041000 Rh4AG293800 Rh4AG293900 Rh4BG299800 Rh4BG299900 Rh4CG315500 Rh4DG296900 Rh4DG297000
rosa_wichuraiana	Rw0G017370 Rw1G002390 Rw4G025430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	644
AccB1I	GGYRCC	1 cut(s)	457
AccI	GTMKAC	2 cut(s)	632, 884
AccII	CGCG	2 cut(s)	615, 875
AclWI	GGATC	2 cut(s)	394, 614
AcoI	YGGCCR	1 cut(s)	478
AcsI	RAATTY	2 cut(s)	128, 791
AcyI	GRCGYC	1 cut(s)	881
AdeI	CACNNNGTG	1 cut(s)	877
AfiI	CCNNNNNNNGG	4 cut(s)	516, 553, 665, 672
AflIII	ACRYGT	1 cut(s)	261
AgsI	TTSAA	8 cut(s)	41, 202, 228, 434, 716, 775, 790, 829
AjiI	CACGTC	1 cut(s)	819
AjuI	GAANNNNNNNTTGG	2 cut(s)	113, 145
AleI	CACNNNNGTG	2 cut(s)	181, 264
AloI	GAACNNNNNNTCC	2 cut(s)	528, 560
AluBI	AGCT	1 cut(s)	544
AluI	AGCT	1 cut(s)	544
Alw21I	GWGCWC	3 cut(s)	261, 476, 546
Alw44I	GTGCAC	2 cut(s)	257, 472
AlwI	GGATC	2 cut(s)	394, 614
AoxI	GGCC	2 cut(s)	478, 697
ApaLI	GTGCAC	2 cut(s)	257, 472
ApoI	RAATTY	2 cut(s)	128, 791
ArsI	GACNNNNNNTTYG	4 cut(s)	783, 808, 815, 840
AsuHPI	GGTGA	5 cut(s)	389, 419, 634, 787, 798
BaeGI	GKGCMC	4 cut(s)	261, 462, 476, 873
BanI	GGYRCC	1 cut(s)	457
BanII	GRGCYC	1 cut(s)	546
BauI	CACGAG	1 cut(s)	177
BbsI	GAAGAC	1 cut(s)	573
Bbv12I	GWGCWC	3 cut(s)	261, 476, 546
BccI	CCATC	2 cut(s)	376, 378
BclI	TGATCA	1 cut(s)	238
BfaI	CTAG	4 cut(s)	92, 317, 516, 866
BfmI	CTRYAG	1 cut(s)	890
BfuAI	ACCTGC	1 cut(s)	644
BisI	GCNGC	5 cut(s)	222, 602, 613, 616, 837
BlsI	GCNGC	5 cut(s)	223, 603, 614, 617, 838
BmgBI	CACGTC	1 cut(s)	819
BmiI	GGNNCC	1 cut(s)	459
BmsI	GCATC	2 cut(s)	16, 151
BpiI	GAAGAC	1 cut(s)	573
BsaHI	GRCGYC	1 cut(s)	881
BsaJI	CCNNGG	2 cut(s)	613, 750
BsaXI	ACNNNNNCTCC	2 cut(s)	528, 558
Bsc4I	CCNNNNNNNGG	4 cut(s)	516, 553, 665, 672
Bse118I	RCCGGY	1 cut(s)	476
BseDI	CCNNGG	2 cut(s)	613, 750
BseGI	GGATG	1 cut(s)	7
BseLI	CCNNNNNNNGG	4 cut(s)	516, 553, 665, 672
BseMII	CTCAG	1 cut(s)	514
BseRI	GAGGAG	1 cut(s)	535
BseSI	GKGCMC	4 cut(s)	261, 462, 476, 873
BsgI	GTGCAG	1 cut(s)	97
Bsh1236I	CGCG	2 cut(s)	615, 875
BshFI	GGCC	2 cut(s)	480, 699
BshNI	GGYRCC	1 cut(s)	457
BsiHKAI	GWGCWC	3 cut(s)	261, 476, 546
BsiSI	CCGG	2 cut(s)	477, 666
BslI	CCNNNNNNNGG	4 cut(s)	516, 553, 665, 672
BsmI	GAATGC	1 cut(s)	212
BsnI	GGCC	2 cut(s)	480, 699
Bsp1286I	GDGCHC	5 cut(s)	261, 462, 476, 546, 873
Bsp143I	GATC	4 cut(s)	193, 238, 386, 619
Bsp19I	CCATGG	1 cut(s)	750
BspANI	GGCC	2 cut(s)	480, 699
BspCNI	CTCAG	1 cut(s)	513
BspFNI	CGCG	2 cut(s)	615, 875
BspLI	GGNNCC	1 cut(s)	459
BspMI	ACCTGC	1 cut(s)	644
BspPI	GGATC	2 cut(s)	394, 614
BspT107I	GGYRCC	1 cut(s)	457
BsrFI	RCCGGY	1 cut(s)	476
BssAI	RCCGGY	1 cut(s)	476
BssECI	CCNNGG	2 cut(s)	613, 750
BssMI	GATC	4 cut(s)	193, 238, 386, 619
BssNI	GRCGYC	1 cut(s)	881
BssSI	CACGAG	1 cut(s)	177
BssT1I	CCWWGG	1 cut(s)	750
Bst2BI	CACGAG	1 cut(s)	177
Bst4CI	ACNGT	3 cut(s)	377, 769, 799
Bst6I	CTCTTC	1 cut(s)	294
BstACI	GRCGYC	1 cut(s)	881
BstC8I	GCNNGC	2 cut(s)	863, 873
BstDEI	CTNAG	2 cut(s)	500, 548
BstDSI	CCRYGG	2 cut(s)	613, 750
BstF5I	GGATG	1 cut(s)	7
BstFNI	CGCG	2 cut(s)	615, 875
BstKTI	GATC	4 cut(s)	196, 241, 389, 622
BstMBI	GATC	4 cut(s)	193, 238, 386, 619
BstMWI	GCNNNNNNNGC	1 cut(s)	230
BstNSI	RCATGY	2 cut(s)	265, 653
BstSFI	CTRYAG	1 cut(s)	890
BstSLI	GKGCMC	4 cut(s)	261, 462, 476, 873
BstUI	CGCG	2 cut(s)	615, 875
BstV2I	GAAGAC	1 cut(s)	573
BstXI	CCANNNNNNTGG	1 cut(s)	183
BsuRI	GGCC	2 cut(s)	480, 699
BtgI	CCRYGG	2 cut(s)	613, 750
BtrI	CACGTC	1 cut(s)	819
BtsCI	GGATG	1 cut(s)	7
BtsI	GCAGTG	1 cut(s)	762
BtsIMutI	CAGTG	2 cut(s)	508, 762
BveI	ACCTGC	1 cut(s)	644
Cac8I	GCNNGC	2 cut(s)	863, 873
Cfr10I	RCCGGY	1 cut(s)	476
Cfr42I	CCGCGG	1 cut(s)	616
CseI	GACGC	1 cut(s)	870
CviAII	CATG	5 cut(s)	104, 133, 262, 650, 751
CviJI	RGCY	9 cut(s)	163, 224, 271, 480, 544, 669, 699, 861, 865
CviKI_1	RGCY	9 cut(s)	163, 224, 271, 480, 544, 669, 699, 861, 865
DdeI	CTNAG	2 cut(s)	500, 548
DpnI	GATC	4 cut(s)	195, 240, 388, 621
DpnII	GATC	4 cut(s)	193, 238, 386, 619
DraI	TTTAAA	1 cut(s)	307
DraIII	CACNNNGTG	1 cut(s)	877
EaeI	YGGCCR	1 cut(s)	478
Eam1104I	CTCTTC	1 cut(s)	294
EarI	CTCTTC	1 cut(s)	294
Ecl136II	GAGCTC	1 cut(s)	544
Eco130I	CCWWGG	1 cut(s)	750
Eco24I	GRGCYC	1 cut(s)	546
Eco32I	GATATC	1 cut(s)	451
Eco53kI	GAGCTC	1 cut(s)	544
EcoICRI	GAGCTC	1 cut(s)	544
EcoRI	GAATTC	1 cut(s)	128
EcoRV	GATATC	1 cut(s)	451
EcoT14I	CCWWGG	1 cut(s)	750
EcoT38I	GRGCYC	1 cut(s)	546
ErhI	CCWWGG	1 cut(s)	750
FaeI	CATG	5 cut(s)	107, 136, 265, 653, 754
FatI	CATG	5 cut(s)	103, 132, 261, 649, 750
FauI	CCCGC	2 cut(s)	690, 832
FbaI	TGATCA	1 cut(s)	238
FblI	GTMKAC	2 cut(s)	632, 884
Fnu4HI	GCNGC	5 cut(s)	222, 602, 613, 616, 837
FriOI	GRGCYC	1 cut(s)	546
Fsp4HI	GCNGC	5 cut(s)	222, 602, 613, 616, 837
FspBI	CTAG	4 cut(s)	92, 317, 516, 866
GluI	GCNGC	5 cut(s)	222, 602, 613, 616, 837
HaeIII	GGCC	2 cut(s)	480, 699
HapII	CCGG	2 cut(s)	477, 666
HgaI	GACGC	1 cut(s)	870
Hin1I	GRCGYC	1 cut(s)	881
Hin1II	CATG	5 cut(s)	107, 136, 265, 653, 754
HincII	GTYRAC	2 cut(s)	633, 885
HindII	GTYRAC	2 cut(s)	633, 885
HinfI	GANTC	5 cut(s)	74, 95, 153, 496, 848
HpaII	CCGG	2 cut(s)	477, 666
HphI	GGTGA	5 cut(s)	389, 419, 634, 787, 798
Hpy166II	GTNNAC	4 cut(s)	259, 474, 633, 885
Hpy188I	TCNGA	6 cut(s)	12, 34, 79, 193, 343, 853
Hpy188III	TCNNGA	2 cut(s)	92, 577
Hpy8I	GTNNAC	4 cut(s)	259, 474, 633, 885
Hpy99I	CGWCG	3 cut(s)	634, 886, 889
HpyAV	CCTTC	3 cut(s)	526, 710, 826
HpyCH4III	ACNGT	3 cut(s)	377, 769, 799
HpyCH4IV	ACGT	1 cut(s)	818
HpyCH4V	TGCA	8 cut(s)	114, 142, 233, 259, 322, 474, 653, 706
HpyF10VI	GCNNNNNNNGC	1 cut(s)	230
HpyF3I	CTNAG	2 cut(s)	500, 548
HpySE526I	ACGT	1 cut(s)	818
Hsp92I	GRCGYC	1 cut(s)	881
Hsp92II	CATG	5 cut(s)	107, 136, 265, 653, 754
Ksp22I	TGATCA	1 cut(s)	238
KspI	CCGCGG	1 cut(s)	616
Kzo9I	GATC	4 cut(s)	193, 238, 386, 619
LmnI	GCTCC	2 cut(s)	4, 549
LpnPI	CCDG	9 cut(s)	71, 203, 394, 490, 506, 562, 649, 679, 847
LweI	GCATC	2 cut(s)	16, 151
MaeI	CTAG	4 cut(s)	92, 317, 516, 866
MaeII	ACGT	1 cut(s)	818
MaeIII	GTNAC	3 cut(s)	505, 757, 804
MalI	GATC	4 cut(s)	195, 240, 388, 621
MboI	GATC	4 cut(s)	193, 238, 386, 619
MboII	GAAGA	4 cut(s)	137, 311, 578, 841
MfeI	CAATTG	1 cut(s)	228
MhlI	GDGCHC	5 cut(s)	261, 462, 476, 546, 873
MluCI	AATT	4 cut(s)	45, 128, 228, 791
MlyI	GAGTC	2 cut(s)	490, 857
MmeI	TCCRAC	1 cut(s)	35
MseI	TTAA	1 cut(s)	306
MslI	CAYNNNNRTG	6 cut(s)	181, 264, 288, 375, 755, 767
MspA1I	CMGCKG	1 cut(s)	615
MspI	CCGG	2 cut(s)	477, 666
MssI	GTTTAAAC	1 cut(s)	307
MunI	CAATTG	1 cut(s)	228
Mva1269I	GAATGC	1 cut(s)	212
MvnI	CGCG	2 cut(s)	615, 875
MwoI	GCNNNNNNNGC	1 cut(s)	230
NcoI	CCATGG	1 cut(s)	750
NdeII	GATC	4 cut(s)	193, 238, 386, 619
NlaIII	CATG	5 cut(s)	107, 136, 265, 653, 754
NlaIV	GGNNCC	1 cut(s)	459
NmuCI	GTSAC	2 cut(s)	757, 804
NspI	RCATGY	2 cut(s)	265, 653
OliI	CACNNNNGTG	2 cut(s)	181, 264
PciI	ACATGT	1 cut(s)	261
PctI	GAATGC	1 cut(s)	212
PfeI	GAWTC	3 cut(s)	74, 95, 153
PkrI	GCNGC	5 cut(s)	223, 603, 614, 617, 838
PleI	GAGTC	2 cut(s)	490, 856
PmeI	GTTTAAAC	1 cut(s)	307
PpsI	GAGTC	2 cut(s)	490, 856
PscI	ACATGT	1 cut(s)	261
Psp124BI	GAGCTC	1 cut(s)	546
PspN4I	GGNNCC	1 cut(s)	459
RseI	CAYNNNNRTG	6 cut(s)	181, 264, 288, 375, 755, 767
SacI	GAGCTC	1 cut(s)	546
SacII	CCGCGG	1 cut(s)	616
SalI	GTCGAC	2 cut(s)	631, 883
SaqAI	TTAA	1 cut(s)	306
SatI	GCNGC	5 cut(s)	222, 602, 613, 616, 837
Sau3AI	GATC	4 cut(s)	193, 238, 386, 619
SchI	GAGTC	2 cut(s)	490, 857
SduI	GDGCHC	5 cut(s)	261, 462, 476, 546, 873
SfaNI	GCATC	2 cut(s)	16, 151
SfcI	CTRYAG	1 cut(s)	890
Sfr303I	CCGCGG	1 cut(s)	616
SgrBI	CCGCGG	1 cut(s)	616
SgrDI	CGTCGACG	1 cut(s)	883
SmiMI	CAYNNNNRTG	6 cut(s)	181, 264, 288, 375, 755, 767
Sse9I	AATT	4 cut(s)	45, 128, 228, 791
SspMI	CTAG	4 cut(s)	92, 317, 516, 866
SstI	GAGCTC	1 cut(s)	546
StyI	CCWWGG	1 cut(s)	750
TaaI	ACNGT	3 cut(s)	377, 769, 799
TaiI	ACGT	1 cut(s)	821
TaqI	TCGA	4 cut(s)	392, 561, 632, 884
TasI	AATT	4 cut(s)	45, 128, 228, 791
TauI	GCSGC	5 cut(s)	224, 604, 615, 618, 839
TfiI	GAWTC	3 cut(s)	74, 95, 153
Tru1I	TTAA	1 cut(s)	306
Tru9I	TTAA	1 cut(s)	306
TscAI	CASTG	2 cut(s)	508, 762
TseFI	GTSAC	2 cut(s)	757, 804
Tsp45I	GTSAC	2 cut(s)	757, 804
TspDTI	ATGAA	5 cut(s)	121, 138, 145, 219, 263
TspGWI	ACGGA	1 cut(s)	618
TspRI	CASTG	2 cut(s)	508, 762
VneI	GTGCAC	2 cut(s)	257, 472
XapI	RAATTY	2 cut(s)	128, 791
XbaI	TCTAGA	1 cut(s)	91
XceI	RCATGY	2 cut(s)	265, 653
XmiI	GTMKAC	2 cut(s)	632, 884
XspI	CTAG	4 cut(s)	92, 317, 516, 866

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.