Rmu_ssc0000008.1_g000024

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000008.1
Physical Location & Seq
Forward (+)
67947 .. 73593
5647 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000008.1_g000024.1.cds

Sequence Viewer

Length: 1161 bp
atgaccaccactcaaacctcctcaactttgccccatttcacccgtccaaggaaatttgaggtcttcctgagtttcagaggtttggacacccgaaaaggttttactgaccacctatacaaggctttatttcttaatggaatccacacgtttagggatgatgaacaacttgagagtgggaagcccatttctttggaactctccaaagcaattcgagaatcagaaatttcagtcatcattctttcaaaaaactatgcaacgtcaacatggtgtctagatgaactagctgaaatggttgaccgcatgaatgagcccggaggactcataatcttgcctgtattctatgacgtgacaccatctcaagtacgagagcagaccggagattcttttaaagaagcgttcgctcaacatgaacacaatttcgtaggggaaacaggaaaggtaacaagatggagagaatctctgaagcaagtcgctggcctctccggatatgatttaagaaattataggcacgaaacagaagtgattcaagcgatagttgaacgcatttttggtgaattgaaatacacaaaccatatattctctaatgatttgaaggactttgttggtattgatcgtgtgcaagaaattgaatcgaacttgtgtatggagtcggagaaaatttctgtagtagggatttgtggcatgccagggattggtaagacaaccgttgcacaagctctttttgtaagaatccgcaatcaatttgaagcttttagtttcatttctaaggttggagaaatatccaagggtgaaaatttctttcctatccaaaaaaaactttgtgaggacttgttgaatagaaaagtaaacatggagaatgtcaatgaagtgataagcaggagattgtggggcaaacgagtgcttatcgttcttgacaacgtggacgaatcaaaacaaatagaggctgtagctggcaatggtgatgaattgtatggtcgatttggtcctggtagtagaatcatcataaccacaagagatgaaaggttgttgataaactatgagccaaaaatatacaaggttgacgcagtcggattgataactaggtttaccagcaataaacctaagcaaaagattctggagtccaccagagataaaagagaaaatctctattatattgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

386

Amino Acids

44.24

Weight (kDa)

6.44

Isoelectric Point (pI)

29.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 692
AccIII TCCGGA 1 cut(s) 482
AciI CCGC 2 cut(s) 298, 733
AcsI RAATTY 4 cut(s) 53, 222, 657, 793
AcuI CTGAAG 1 cut(s) 482
AfaI GTAC 1 cut(s) 363
AfiI CCNNNNNNNGG 3 cut(s) 48, 118, 692
AflIII ACRYGT 1 cut(s) 144
AgsI TTSAA 8 cut(s) 243, 527, 539, 559, 592, 629, 746, 835
AjiI CACGTC 1 cut(s) 346
AjnI CCWGG 2 cut(s) 685, 985
AjuI GAANNNNNNNTTGG 2 cut(s) 531, 563
AluBI AGCT 4 cut(s) 284, 716, 749, 950
AluI AGCT 4 cut(s) 284, 716, 749, 950
Aor13HI TCCGGA 1 cut(s) 482
AoxI GGCC 1 cut(s) 475
ApoI RAATTY 4 cut(s) 53, 222, 657, 793
Asp700I GAANNNNTTC 1 cut(s) 522
AspS9I GGNCC 1 cut(s) 983
AsuC2I CCSGG 1 cut(s) 312
AsuHPI GGTGA 4 cut(s) 31, 563, 800, 971
AvaII GGWCC 1 cut(s) 983
BanII GRGCYC 1 cut(s) 312
BbsI GAAGAC 1 cut(s) 55
BccI CCATC 2 cut(s) 361, 441
BciT130I CCWGG 2 cut(s) 687, 987
BcnI CCSGG 1 cut(s) 312
BfaI CTAG 3 cut(s) 272, 281, 1080
BfmI CTRYAG 2 cut(s) 663, 945
Bme1390I CCNGG 3 cut(s) 312, 687, 987
Bme18I GGWCC 1 cut(s) 983
BmgBI CACGTC 1 cut(s) 346
BmgT120I GGNCC 1 cut(s) 983
BmrFI CCNGG 3 cut(s) 312, 687, 987
BpiI GAAGAC 1 cut(s) 55
BplI GAGNNNNNCTC 4 cut(s) 442, 474, 1128, 1160
BpmI CTGGAG 1 cut(s) 1136
Bpu10I CCTNAGC 1 cut(s) 1101
BpuEI CTTGAG 2 cut(s) 188, 342
BpuMI CCSGG 1 cut(s) 312
BsaJI CCNNGG 3 cut(s) 47, 686, 783
BsaWI WCCGGW 2 cut(s) 374, 482
Bsc4I CCNNNNNNNGG 3 cut(s) 48, 118, 692
Bse3DI GCAATG 1 cut(s) 961
BseAI TCCGGA 1 cut(s) 482
BseBI CCWGG 2 cut(s) 687, 987
BseDI CCNNGG 3 cut(s) 47, 686, 783
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 3 cut(s) 48, 118, 692
BseMI GCAATG 1 cut(s) 961
BseMII CTCAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 10
BshFI GGCC 1 cut(s) 477
BsiSI CCGG 3 cut(s) 312, 375, 483
BslI CCNNNNNNNGG 3 cut(s) 48, 118, 692
BsnI GGCC 1 cut(s) 477
Bsp1286I GDGCHC 1 cut(s) 312
Bsp13I TCCGGA 1 cut(s) 482
Bsp143I GATC 1 cut(s) 610
BspACI CCGC 2 cut(s) 298, 733
BspANI GGCC 1 cut(s) 477
BspCNI CTCAG 1 cut(s) 60
BspEI TCCGGA 1 cut(s) 482
BsrDI GCAATG 1 cut(s) 961
BssECI CCNNGG 3 cut(s) 47, 686, 783
BssMI GATC 1 cut(s) 610
BssT1I CCWWGG 2 cut(s) 47, 783
Bst2UI CCWGG 2 cut(s) 687, 987
Bst4CI ACNGT 1 cut(s) 706
BstC8I GCNNGC 3 cut(s) 475, 683, 952
BstDEI CTNAG 3 cut(s) 68, 765, 1101
BstENI CCTNNNNNAGG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 1 cut(s) 613
BstMBI GATC 1 cut(s) 610
BstNI CCWGG 2 cut(s) 687, 987
BstNSI RCATGY 1 cut(s) 685
BstSCI CCNGG 3 cut(s) 310, 685, 985
BstSFI CTRYAG 2 cut(s) 663, 945
BstV2I GAAGAC 1 cut(s) 55
BstXI CCANNNNNNTGG 1 cut(s) 190
BsuRI GGCC 1 cut(s) 477
BtrI CACGTC 1 cut(s) 346
BtsCI GGATG 1 cut(s) 160
Cac8I GCNNGC 3 cut(s) 475, 683, 952
Cfr13I GGNCC 1 cut(s) 983
CseI GACGC 1 cut(s) 1070
Csp6I GTAC 1 cut(s) 362
CviAII CATG 5 cut(s) 264, 301, 407, 682, 850
CviQI GTAC 1 cut(s) 362
DdeI CTNAG 3 cut(s) 68, 765, 1101
DpnI GATC 1 cut(s) 612
DpnII GATC 1 cut(s) 610
DraI TTTAAA 1 cut(s) 388
Eco130I CCWWGG 2 cut(s) 47, 783
Eco24I GRGCYC 1 cut(s) 312
Eco47I GGWCC 1 cut(s) 983
Eco57I CTGAAG 1 cut(s) 482
EcoNI CCTNNNNNAGG 1 cut(s) 116
EcoRII CCWGG 2 cut(s) 685, 985
EcoT14I CCWWGG 2 cut(s) 47, 783
EcoT38I GRGCYC 1 cut(s) 312
ErhI CCWWGG 2 cut(s) 47, 783
FaeI CATG 5 cut(s) 267, 304, 410, 685, 853
FatI CATG 5 cut(s) 263, 300, 406, 681, 849
FokI GGATG 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 312
FspBI CTAG 3 cut(s) 272, 281, 1080
GsuI CTGGAG 1 cut(s) 1136
HaeIII GGCC 1 cut(s) 477
HapII CCGG 3 cut(s) 312, 375, 483
HgaI GACGC 1 cut(s) 1070
Hin1II CATG 5 cut(s) 267, 304, 410, 685, 853
HincII GTYRAC 3 cut(s) 261, 295, 1060
HindII GTYRAC 3 cut(s) 261, 295, 1060
HindIII AAGCTT 1 cut(s) 747
HpaII CCGG 3 cut(s) 312, 375, 483
HphI GGTGA 4 cut(s) 31, 563, 800, 971
Hpy166II GTNNAC 7 cut(s) 261, 295, 847, 922, 1060, 1086, 1122
Hpy188I TCNGA 5 cut(s) 77, 220, 462, 652, 1070
Hpy188III TCNNGA 6 cut(s) 67, 212, 272, 483, 911, 1115
Hpy8I GTNNAC 7 cut(s) 261, 295, 847, 922, 1060, 1086, 1122
HpyAV CCTTC 1 cut(s) 586
HpyCH4III ACNGT 1 cut(s) 706
HpyCH4IV ACGT 4 cut(s) 146, 257, 345, 918
HpyCH4V TGCA 3 cut(s) 254, 619, 710
HpyF3I CTNAG 3 cut(s) 68, 765, 1101
HpySE526I ACGT 4 cut(s) 146, 257, 345, 918
Hsp92II CATG 5 cut(s) 267, 304, 410, 685, 853
Kpn2I TCCGGA 1 cut(s) 482
Kzo9I GATC 1 cut(s) 610
MaeI CTAG 3 cut(s) 272, 281, 1080
MaeII ACGT 4 cut(s) 146, 257, 345, 918
MaeIII GTNAC 2 cut(s) 346, 439
MalI GATC 1 cut(s) 612
MboI GATC 1 cut(s) 610
MboII GAAGA 1 cut(s) 55
MhlI GDGCHC 1 cut(s) 312
MlyI GAGTC 3 cut(s) 312, 656, 1127
MmeI TCCRAC 3 cut(s) 630, 751, 1048
MnlI CCTC 8 cut(s) 28, 31, 52, 71, 308, 488, 817, 934
MroI TCCGGA 1 cut(s) 482
MroXI GAANNNNTTC 1 cut(s) 522
MseI TTAA 4 cut(s) 132, 387, 494, 1159
MspI CCGG 3 cut(s) 312, 375, 483
MspR9I CCNGG 3 cut(s) 312, 687, 987
MvaI CCWGG 2 cut(s) 687, 987
NciI CCSGG 1 cut(s) 312
NdeII GATC 1 cut(s) 610
NlaIII CATG 5 cut(s) 267, 304, 410, 685, 853
NmuCI GTSAC 1 cut(s) 346
NspI RCATGY 1 cut(s) 685
PaeI GCATGC 1 cut(s) 685
PdmI GAANNNNTTC 1 cut(s) 522
PflFI GACNNNGTC 1 cut(s) 1064
PflMI CCANNNNNTGG 1 cut(s) 692
PleI GAGTC 3 cut(s) 312, 655, 1126
PpsI GAGTC 3 cut(s) 312, 655, 1126
Psp6I CCWGG 2 cut(s) 685, 985
PspGI CCWGG 2 cut(s) 685, 985
PspPI GGNCC 1 cut(s) 983
PsyI GACNNNGTC 1 cut(s) 1064
RsaI GTAC 1 cut(s) 363
RsaNI GTAC 1 cut(s) 362
SaqAI TTAA 4 cut(s) 132, 387, 494, 1159
Sau3AI GATC 1 cut(s) 610
Sau96I GGNCC 1 cut(s) 983
SchI GAGTC 3 cut(s) 312, 656, 1127
ScrFI CCNGG 3 cut(s) 312, 687, 987
SduI GDGCHC 1 cut(s) 312
SfcI CTRYAG 2 cut(s) 663, 945
SinI GGWCC 1 cut(s) 983
SmlI CTYRAG 2 cut(s) 167, 357
SmoI CTYRAG 2 cut(s) 167, 357
SphI GCATGC 1 cut(s) 685
SsiI CCGC 2 cut(s) 298, 733
SspMI CTAG 3 cut(s) 272, 281, 1080
StyD4I CCNGG 3 cut(s) 310, 685, 985
StyI CCWWGG 2 cut(s) 47, 783
TaaI ACNGT 1 cut(s) 706
TaiI ACGT 4 cut(s) 149, 260, 348, 921
TaqI TCGA 3 cut(s) 211, 632, 976
Tru1I TTAA 4 cut(s) 132, 387, 494, 1159
Tru9I TTAA 4 cut(s) 132, 387, 494, 1159
TseFI GTSAC 1 cut(s) 346
Tsp45I GTSAC 1 cut(s) 346
TspDTI ATGAA 8 cut(s) 174, 291, 317, 423, 748, 879, 978, 1032
Tth111I GACNNNGTC 1 cut(s) 1064
Van91I CCANNNNNTGG 1 cut(s) 692
VpaK11BI GGWCC 1 cut(s) 983
XagI CCTNNNNNAGG 1 cut(s) 116
XapI RAATTY 4 cut(s) 53, 222, 657, 793
XbaI TCTAGA 1 cut(s) 271
XceI RCATGY 1 cut(s) 685
XmnI GAANNNNTTC 1 cut(s) 522
XspI CTAG 3 cut(s) 272, 281, 1080
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.