Rroxscaffold_3G00269640

resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001545
Physical Location & Seq
Forward (+)
62464498 .. 62466277
1780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00269640.1

Sequence Viewer

Length: 387 bp
ATGGCTGCATCTAGAAGGATTCATATGGGTTTCTTACATACCACAAAGGTCGTTGATTTTGGATCATCGAATGAGTGCATCGACCTACAGGCTTCGATTGGAAGTGACCGCCCAGGCTTAAGGGTGCTCAAGTGTGGGCTTCCTCTTCTATATGAACATGATGAGCAAGAATTTGAGAAGACCATTATGCATTGCAGGACCTCGTTGTCTGATCATCTAGGAAATTTACAAAGTTTGTTGAGACCCACTGTTAAAAAAGATATTGAGCCACTTGCAAATCCAAACAGAGGCCCAACAATAATGGGCTCGGGTCAAAATTGCAGACCCCAAAACCCATTTCTCACCACCACCAAGGGTTTAAGCTCCCCAAAACCTCCACAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

128

Amino Acids

14.11

Weight (kDa)

8.8

Isoelectric Point (pI)

58.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 205
AciI CCGC 1 cut(s) 109
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 2 cut(s) 170, 223
AfiI CCNNNNNNNGG 1 cut(s) 287
AflII CTTAAG 1 cut(s) 118
AjnI CCWGG 1 cut(s) 112
AjuI GAANNNNNNNTTGG 2 cut(s) 321, 353
AluBI AGCT 2 cut(s) 363, 384
AluI AGCT 2 cut(s) 363, 384
Alw21I GWGCWC 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 235
AlwI GGATC 1 cut(s) 70
Ama87I CYCGRG 1 cut(s) 307
AoxI GGCC 1 cut(s) 289
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 2 cut(s) 170, 223
AspS9I GGNCC 2 cut(s) 198, 290
AsuHPI GGTGA 1 cut(s) 334
AvaI CYCGRG 1 cut(s) 307
AvaII GGWCC 1 cut(s) 198
BanII GRGCYC 1 cut(s) 308
BbsI GAAGAC 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 129
BciT130I CCWGG 1 cut(s) 114
BclI TGATCA 1 cut(s) 211
BcoDI GTCTC 1 cut(s) 235
BfaI CTAG 3 cut(s) 12, 218, 385
BfmI CTRYAG 1 cut(s) 86
BfrI CTTAAG 1 cut(s) 118
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 114
Bme18I GGWCC 1 cut(s) 198
BmeT110I CYCGRG 1 cut(s) 307
BmgT120I GGNCC 2 cut(s) 198, 290
BmrFI CCNGG 1 cut(s) 114
BmsI GCATC 2 cut(s) 17, 87
BpiI GAAGAC 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 113
BsaI GGTCTC 1 cut(s) 235
BsaJI CCNNGG 2 cut(s) 112, 351
Bsc4I CCNNNNNNNGG 1 cut(s) 287
Bse3DI GCAATG 1 cut(s) 190
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 2 cut(s) 112, 351
BseLI CCNNNNNNNGG 1 cut(s) 287
BseMI GCAATG 1 cut(s) 190
BshFI GGCC 1 cut(s) 291
BsiHKAI GWGCWC 1 cut(s) 129
BsiHKCI CYCGRG 1 cut(s) 307
BslI CCNNNNNNNGG 1 cut(s) 287
BsmAI GTCTC 1 cut(s) 235
BsnI GGCC 1 cut(s) 291
Bso31I GGTCTC 1 cut(s) 235
BsoBI CYCGRG 1 cut(s) 307
Bsp1286I GDGCHC 2 cut(s) 129, 308
Bsp143I GATC 2 cut(s) 62, 211
BspACI CCGC 1 cut(s) 109
BspANI GGCC 1 cut(s) 291
BspPI GGATC 1 cut(s) 70
BspTI CTTAAG 1 cut(s) 118
BspTNI GGTCTC 1 cut(s) 235
BsrDI GCAATG 1 cut(s) 190
BssECI CCNNGG 2 cut(s) 112, 351
BssMI GATC 2 cut(s) 62, 211
BssT1I CCWWGG 1 cut(s) 351
Bst2UI CCWGG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 250
Bst6I CTCTTC 1 cut(s) 150
BstAFI CTTAAG 1 cut(s) 118
BstKTI GATC 2 cut(s) 65, 214
BstMAI GTCTC 1 cut(s) 235
BstMBI GATC 2 cut(s) 62, 211
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 185
BsuRI GGCC 1 cut(s) 291
BtsIMutI CAGTG 1 cut(s) 246
Cfr13I GGNCC 2 cut(s) 198, 290
CviAII CATG 1 cut(s) 158
CviJI RGCY 9 cut(s) 5, 92, 117, 139, 268, 291, 306, 363, 384
CviKI_1 RGCY 9 cut(s) 5, 92, 117, 139, 268, 291, 306, 363, 384
DpnI GATC 2 cut(s) 64, 213
DpnII GATC 2 cut(s) 62, 211
DrdI GACNNNNNNGTC 1 cut(s) 205
DseDI GACNNNNNNGTC 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco130I CCWWGG 1 cut(s) 351
Eco24I GRGCYC 1 cut(s) 308
Eco31I GGTCTC 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 198
Eco88I CYCGRG 1 cut(s) 307
EcoO109I RGGNCCY 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 112
EcoT14I CCWWGG 1 cut(s) 351
EcoT22I ATGCAT 1 cut(s) 192
EcoT38I GRGCYC 1 cut(s) 308
ErhI CCWWGG 1 cut(s) 351
FaeI CATG 1 cut(s) 161
FaiI YATR 7 cut(s) 24, 26, 39, 151, 153, 159, 188
FatI CATG 1 cut(s) 157
FauNDI CATATG 1 cut(s) 24
FbaI TGATCA 1 cut(s) 211
Fnu4HI GCNGC 1 cut(s) 6
FriOI GRGCYC 1 cut(s) 308
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 3 cut(s) 12, 218, 385
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 291
Hin1II CATG 1 cut(s) 161
HinfI GANTC 1 cut(s) 19
HphI GGTGA 1 cut(s) 334
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 9
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4V TGCA 6 cut(s) 8, 78, 190, 195, 275, 321
Hsp92II CATG 1 cut(s) 161
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 2 cut(s) 62, 211
LmnI GCTCC 1 cut(s) 368
LpnPI CCDG 4 cut(s) 74, 99, 126, 181
LweI GCATC 2 cut(s) 17, 87
MaeI CTAG 3 cut(s) 12, 218, 385
MaeIII GTNAC 1 cut(s) 104
MalI GATC 2 cut(s) 64, 213
MboI GATC 2 cut(s) 62, 211
MboII GAAGA 2 cut(s) 137, 190
MhlI GDGCHC 2 cut(s) 129, 308
MluCI AATT 3 cut(s) 170, 223, 316
MnlI CCTC 4 cut(s) 153, 211, 281, 384
Mph1103I ATGCAT 1 cut(s) 192
MseI TTAA 3 cut(s) 119, 252, 359
MspCI CTTAAG 1 cut(s) 118
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeI CATATG 1 cut(s) 24
NdeII GATC 2 cut(s) 62, 211
NlaIII CATG 1 cut(s) 161
NmuCI GTSAC 1 cut(s) 104
NsiI ATGCAT 1 cut(s) 192
PfeI GAWTC 1 cut(s) 19
PkrI GCNGC 1 cut(s) 7
PpuMI RGGWCCY 1 cut(s) 198
Psp5II RGGWCCY 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspPI GGNCC 2 cut(s) 198, 290
PspPPI RGGWCCY 1 cut(s) 198
SaqAI TTAA 3 cut(s) 119, 252, 359
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 62, 211
Sau96I GGNCC 2 cut(s) 198, 290
ScrFI CCNGG 1 cut(s) 114
SduI GDGCHC 2 cut(s) 129, 308
SetI ASST 6 cut(s) 51, 87, 203, 365, 376, 386
SfaNI GCATC 2 cut(s) 17, 87
SfcI CTRYAG 1 cut(s) 86
SinI GGWCC 1 cut(s) 198
SmlI CTYRAG 2 cut(s) 118, 128
SmoI CTYRAG 2 cut(s) 118, 128
Sse9I AATT 3 cut(s) 170, 223, 316
SsiI CCGC 1 cut(s) 109
SspMI CTAG 3 cut(s) 12, 218, 385
StyD4I CCNGG 1 cut(s) 112
StyI CCWWGG 1 cut(s) 351
TaaI ACNGT 1 cut(s) 250
TaqI TCGA 3 cut(s) 68, 81, 95
TasI AATT 3 cut(s) 170, 223, 316
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 3 cut(s) 119, 252, 359
Tru9I TTAA 3 cut(s) 119, 252, 359
TscAI CASTG 1 cut(s) 253
TseFI GTSAC 1 cut(s) 104
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 104
TspDTI ATGAA 2 cut(s) 11, 168
TspRI CASTG 1 cut(s) 253
Vha464I CTTAAG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 198
XapI RAATTY 2 cut(s) 170, 223
XbaI TCTAGA 1 cut(s) 11
XspI CTAG 3 cut(s) 12, 218, 385
Zsp2I ATGCAT 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.