Rmu_sc0032226.1_g000001

Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032226.1
Physical Location & Seq
Reverse (-)
707 .. 1072
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032226.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
atgcaggaatgcaggaggcgtggcctcaatgttgcagtggcaggaattccaaaaaccattgataatgatattccggttatagacaagtcctttggttttgacactgctgttgaggaggctcaacgagccattaatgcagctcatgttgaagcagaaagcattgagaatggtatcggcgttgtcaagttaatgggtcgctacagtggtaaaatgttatttctctatagaatctttcaagttatccaatttaagagtattttacagaacatcaactga

Protein Analysis

91

Amino Acids

10.17

Weight (kDa)

7.89

Isoelectric Point (pI)

39.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 45
AgsI TTSAA 2 cut(s) 149, 236
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AoxI GGCC 1 cut(s) 22
ApeKI GCWGC 1 cut(s) 137
ApoI RAATTY 1 cut(s) 45
ArsI GACNNNNNNTTYG 2 cut(s) 74, 106
AseI ATTAAT 1 cut(s) 132
BbvI GCAGC 1 cut(s) 149
BfmI CTRYAG 2 cut(s) 199, 223
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
BsaWI WCCGGW 1 cut(s) 73
BseRI GAGGAG 1 cut(s) 128
BseXI GCAGC 1 cut(s) 149
BshFI GGCC 1 cut(s) 24
BsiSI CCGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 14
BsnI GGCC 1 cut(s) 24
BspANI GGCC 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 203
BstMWI GCNNNNNNNGC 2 cut(s) 125, 134
BstSFI CTRYAG 2 cut(s) 199, 223
BstV1I GCAGC 1 cut(s) 149
BsuRI GGCC 1 cut(s) 24
BtsI GCAGTG 2 cut(s) 42, 102
BtsIMutI CAGTG 3 cut(s) 42, 102, 208
CviAII CATG 1 cut(s) 143
CviJI RGCY 4 cut(s) 24, 119, 128, 140
CviKI_1 RGCY 4 cut(s) 24, 119, 128, 140
EcoRI GAATTC 1 cut(s) 45
FaeI CATG 1 cut(s) 146
FaiI YATR 3 cut(s) 80, 144, 225
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 138
GluI GCNGC 1 cut(s) 138
HaeIII GGCC 1 cut(s) 24
HapII CCGG 1 cut(s) 74
Hin1II CATG 1 cut(s) 146
HinfI GANTC 1 cut(s) 228
HpaII CCGG 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 4 cut(s) 4, 12, 35, 137
HpyF10VI GCNNNNNNNGC 2 cut(s) 125, 134
Hsp92II CATG 1 cut(s) 146
LpnPI CCDG 2 cut(s) 27, 87
Lsp1109I GCAGC 1 cut(s) 149
MluCI AATT 2 cut(s) 45, 245
MnlI CCTC 4 cut(s) 9, 35, 106, 109
MseI TTAA 3 cut(s) 132, 188, 249
MspI CCGG 1 cut(s) 74
Mva1269I GAATGC 1 cut(s) 14
MwoI GCNNNNNNNGC 2 cut(s) 125, 134
NlaIII CATG 1 cut(s) 146
PctI GAATGC 1 cut(s) 14
PfeI GAWTC 1 cut(s) 228
PkrI GCNGC 1 cut(s) 139
PshBI ATTAAT 1 cut(s) 132
SaqAI TTAA 3 cut(s) 132, 188, 249
SatI GCNGC 1 cut(s) 138
SetI ASST 1 cut(s) 142
SfcI CTRYAG 2 cut(s) 199, 223
Sse9I AATT 2 cut(s) 45, 245
TaaI ACNGT 1 cut(s) 203
TasI AATT 2 cut(s) 45, 245
TfiI GAWTC 1 cut(s) 228
Tru1I TTAA 3 cut(s) 132, 188, 249
Tru9I TTAA 3 cut(s) 132, 188, 249
TscAI CASTG 3 cut(s) 42, 109, 208
TseI GCWGC 1 cut(s) 137
TspRI CASTG 3 cut(s) 42, 109, 208
VspI ATTAAT 1 cut(s) 132
XapI RAATTY 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.